Anti dig ap antibody

Manufactured by Roche

Sourced in Switzerland, Germany

The Anti-DIG-AP antibody is a detection reagent commonly used in various laboratory applications. It is an antibody conjugated with alkaline phosphatase (AP), which allows for the detection and visualization of digoxigenin (DIG)-labeled targets. This antibody can be utilized in techniques such as Northern blotting, Southern blotting, and in situ hybridization to identify and quantify DIG-labeled nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

Bm purple, by Roche (7 mentions) Nbt bcip substrate, by Roche (5 mentions) Dig rna labeling kit, by Roche (5 mentions) Blocking reagent, by Roche (5 mentions) Bx3 cbh microscope, by Olympus (3 mentions) Proteinase k, by Roche (3 mentions) Nbt bcip, by Roche (3 mentions) Bcip nbt, by Merck Group (3 mentions) Maxiscript t7 kit, by Thermo Fisher Scientific (2 mentions) Dig 11 utp, by Roche (2 mentions) Alphaphot 2 ys2, by Nikon (2 mentions) Dig labeling mix, by Roche (2 mentions) Dig rna labeling mix, by Roche (2 mentions) N nylon membrane, by Merck Group (2 mentions) Dig labelling kit, by Roche (2 mentions) Nbt bcip solution, by Roche (2 mentions) Bm purple substrate, by Roche (2 mentions) Rna labeling kit, by Roche (2 mentions) Alkaline phosphatase chromogen bcip nbt substrate, by Vector Laboratories (2 mentions) Megascript t7 kit, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

Anti-DIG antibody (108 citations) Anti-DIG-AP (53 citations) AP)-conjugated anti-DIG antibody (43 citations) Anti-DIG-AP antibody conjugate (6 citations) AP)‐labeled anti‐DIG antibody (3 citations) Anti-DIG-AP antibody Fab fragment (2 citations) AP-conjugated sheep anti-DIG antibody (2 citations) AP)-conjugated anti-digoxygenin (DIG) antibody (2 citations) Anti-DIG-AP Fab antibody (2 citations) Anti-DIG-AP antibody solution (2 citations)

60 protocols using anti dig ap antibody

In situ hybridization of Wnt signaling in mouse embryos

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse embryos were fixed with 4% PFA/PBS at 4 °C overnight, and then tracheas were dissected. Specimens were incubated in sucrose gradient (10, 20, and 30%) and embedded in OCT compound. Frozen sections (12-μm) were subjected to in situ hybridization. For Wnt2, 4, 5a, 7b probe construction, cDNA fragments were amplified by primers listed in Supplementary Table 2. These cDNA fragments were subcloned into pBluscript SK+ at EcoRI and SalI sites. For Wnt5b and six probes, pSPROT1-Wnt5b (MCH085322) and pSPROT1-Wnt6 (MCH000524) were linearized at SalI sites, The NIA/NIH Mouse 15 K and 7.4 K cDNA Clones were provided by the RIKEN BRC^{55 (link)–57 (link)}. Antisense cRNA transcripts were synthesized with DIG labeling mix (Roche Life Science) and T3 or SP6 RNA polymerase (New England Biolabs Inc.). Slides were permeabilized in 0.1% Triton-X100/PBS for 30 min and blocked in acetylation buffer. After prehybridization, slides were hybridized with 500 ng/ml of DIG-labeled cRNA probes overnight at 65 °C. After washing with SSC, slides were incubated with anti-DIG-AP antibodies (1:1000, Roche Life Science, 11093274910). Sections were colored with BM-purple (Roche Life Science, 11442074001).
For RNAscope experiments, the RNAscope Multiplex Fluorescent v2 assays (Advanced Cell Diagnostics, 323110) were used. The detailed procedure and probes were listed on Supplementary Table 3.

Kishimoto K., Furukawa K.T., Luz-Madrigal A., Yamaoka A., Matsuoka C., Habu M., Alev C., Zorn A.M, & Morimoto M. (2020). Bidirectional Wnt signaling between endoderm and mesoderm confers tracheal identity in mouse and human cells. Nature Communications, 11, 4159.

+ Open protocol

+ Expand

In situ hybridization of cdi gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ovary dissection, fixation, proteinase K treatment, re-fixation and hybridization steps were performed as described (PMID: 29813067). Matrices for probe preparation were prepared by PCR using cdi_F ATGTCGGAAACACTGCCACT and cdi_R GATAATACGACTCACTATAGGCAACTAACGATCCGATGC primers of genomic DNA of the cdi^A strain. Labeling of RNA probes with DIG-11-UTP (Roche, Switzerland) was made by MAXIscript T7 kit (Ambion, Austin, TX, USA). Anti-DIG-AP antibodies (Roche, Basel, Switzerland) were used in 1:2000 dilution. Images obtained by binocular microscope Nikon Alphaphot-2 YS2 (Tokyo, Japan).

Dorador A.P., Dalikova M., Cerbin S., Stillman C.M., Zych M.G., Hawley R.S., Miller D.E., Ray D.A., Funikov S.Y., Evgen’ev M.B, & Blumenstiel J.P. (2022). Paramutation-like Epigenetic Conversion by piRNA at the Telomere of Drosophila virilis. Biology, 11(10), 1480.

+ Open protocol

+ Expand

In situ hybridization of ovarian tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dissection of ovaries, fixation, Proteinase K treatment, re-fixation and hybridization steps were performed as described [24 (link)].
Matrices for probe preparation were prepared by PCR (sequences of used primers are shown in S1 Table) of genomic DNA of 160 strain. Labeling of RNA probes with DIG-11-UTP (Roche, France) was made by MAXIscript T7 kit (Ambion, USA). Anti-DIG-AP antibodies (Roche, France) were used in 1:2000 dilution. Images obtained by binocular microscope Nikon Alphaphot-2 YS2 (Japan).

Funikov S.Y., Kulikova D.A., Krasnov G.S., Rezvykh A.P., Chuvakova L.N., Shostak N.G., Zelentsova E.S., Blumenstiel J.P, & Evgen’ev M.B. (2018). Spontaneous gain of susceptibility suggests a novel mechanism of resistance to hybrid dysgenesis in Drosophila virilis. PLoS Genetics, 14(5), e1007400.

+ Open protocol

+ Expand

In Situ Hybridization of Wnt5a in Tracheal Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

For frozen sections, tracheas were incubated in 30% sucrose before embedding in OCT compound. In situ hybridization was performed on frozen sections (16 μm). Wnt5a cDNA (Genbank; NM001256224.1 nucleotids 95-402) was amplified by following primers; 5′-ATA GTC GAC ATG GCT TTG GCC ACG TTT TT-3′ and 5′-ATA GAA TTC ATT TGC ATC ACC CTG CCA AA-3′, and subcloned to pBluescriptII SK. DIG-labeled cRNA probe was synthesized with mMESSAGE mMACHINE kit (Ambion) and DIG RNA labeling mix (Roche Life Science). Sections were permeabilized in 0.1% Triton X-100/PBS for 30 min and blocked in acetylation buffer. After prehybridization, sections were hybridized with DIG-labeled RNA probe (500 ng mL⁻¹) overnight at 65 °C. Subsequently, sections were washed, and incubated with anti-DIG-AP antibodies (1:1000, Roche Life Science, 11 093 274 910), and colored with BM-purple (Roche Life Science, 11442074001).

Kishimoto K., Tamura M., Nishita M., Minami Y., Yamaoka A., Abe T., Shigeta M, & Morimoto M. (2018). Synchronized mesenchymal cell polarization and differentiation shape the formation of the murine trachea and esophagus. Nature Communications, 9, 2816.

+ Open protocol

+ Expand

In Situ Detection of BC200 in HCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ detection of BC200 expression was performed on formalin-fixed paraffin-embedded HCC samples. BC200 anti-sense RNA probes were labeled with digoxigenin (DIG) using a DIG RNA labeling kit (Roche). Before the labeling reaction, BC200 plasmid was digested with restriction enzymes for linearization. Further, in vitro transcription from plasmid was carried out using SP6 RNA polymerase. After de-paraffinization and rehydration, samples were treated with proteinase K (20 μg/mL) to digest tissues before hybridization, which was conducted at 37°C for 30 min. Sections were prehybridized in buffer containing 4xSSC and 50% deionized formamide for at least 10 min at 37°C and hybridized overnight with DIG-labeled probe at 62°C in solution containing 40% deionized formamide, 10% dextran sulfate, 1× Denhardt's solution, 4× SSC, 10 mM DTT and 1 µg/mL yeast t-RNA. After stringent washing, signals were detected using anti-DIG-AP antibodies (1:800 dilution, Roche) and NBT/BCIP substrate (Roche).

Lin Y.H., Wu M.H., Huang Y.H., Yeh C.T., Chi H.C., Tsai C.Y., Chuang W.Y., Yu C.J., Chung I.H., Chen C.Y, & Lin K.H. (2018). Thyroid hormone negatively regulates tumorigenesis through suppression of BC200. Endocrine-related cancer, 25(12).

+ Open protocol

+ Expand

Northern Blot Analysis of Human CPE mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Northern blot analysis was performed using a Northern Max kit (Ambion- Thermo Fisher Scientific) according to the manufacturer’s instructions. Briefly, a 188 bp human DIG (digoxigenin)-labeled (DIG RNA labeling kit, Roche, Mannheim, Germany) CPE probe covering the middle region (1241–1428 nt) of human CPE mRNA (GenBank accession number: NM_001873.2) was used. Messenger RNA samples (2.5 µg) were run on a denaturing formaldehyde gel and blotted to a nylon membrane. Membranes were hybridized overnight at 50 °C, washed and processed for immunodetection using an anti-DIG-AP antibody (1:10,000, Roche) and visualized by CSPD [Disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2′-(5′-chloro)tricyclo [3.3.1.1]decan}-4-yl)phenyl phosphate] chemiluminescence substrate (1:100, Roche) against X-film.

Hareendran S., Yang X., Lou H., Xiao L, & Loh Y.P. (2019). Carboxypeptidase E-∆N Promotes Proliferation and Invasion of Pancreatic Cancer Cells via Upregulation of CXCR2 Gene Expression. International Journal of Molecular Sciences, 20(22), 5725.

+ Open protocol

+ Expand

In Situ Hybridization of mTrem1 in Kidney Tissue

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ hybridization was performed on frozen tissue sections as described before15 (link)52 (link) with minor adjustments. A DNA template was generated by nested PCR incorporation of T7 RNA polymerase promoters using mTrem1 primers (forward: 5′-GCGTGTTCTTTGTCTCAGAAGT and reverse 5′-taatacgactcactataggg AGGAGAGGAAACAACCGCAG). Kidneys were perfused with PBS, fixated in 4% PFA and placed in 30% sucrose overnight at 4 °C. The next day, the tissues was placed in O.C.T. compound (Tissue-Tek). The kidney tissue sections (5 μm) were permeabilised with proteinase K (10 μg/ml), fixated and next acetylated. Riboprobe concentration of 0.5 μg/ml was used for hybridization. For riboprobe detection, sections were pre-treated with blocking buffer (20% heat inactivated sheep serum, 2% blocking reagent; Hoffmann-La Roche) and incubated with anti–DIG-AP antibody (Hoffmann-La Roche) at 4 °C overnight. The next day, a chromogenic substrate (BM Purple; Hoffmann-La Roche) was used to visualize the signal. Sections were fixated in 4% PFA and mounted with Glycergel (Dako).

Tammaro A., Kers J., Emal D., Stroo I., Teske G.J., Butter L.M., Claessen N., Damman J., Derive M., Navis G.J., Florquin S., Leemans J.C, & Dessing M.C. (2016). Effect of TREM-1 blockade and single nucleotide variants in experimental renal injury and kidney transplantation. Scientific Reports, 6, 38275.

+ Open protocol

+ Expand

Whole-mount in situ Hybridization for Maternal mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate knockdown effects on maternal mRNAs, whole-mount in situ hybridization17 (link)22 (link)25 (link) was carried out. RNA probes were designed for the same sequences to PCR products used for DNAi. Eggs were treated with 0.05% Actinase E (Funakoshi, Tokyo, Japan) and 1% sodium thioglycolate (Sigma, Tokyo, Japan) in seawater for 4 min at room temperature to digest the vitelline membrane, and fixed with 4% paraformaldehyde in 0.1 M MOPS and 0.5 M NaCl. To remove injected PCR products, specimens were treated with 2 U/ml Turbo DNase and 20 μg/ml proteinase K (Thermo Fisher Scientific, Yokohama, Japan) at 37 °C for 15 min, fixed again with 4% paraformaldehyde, and subjected for hybridization with DIG-labeled RNA probes in hybridization buffer (50% de-ionized formamide, 5X SSC, 0.1% Tween-20, 50 mg/ml Heparin, 100 mg/ml E. coli tRNA) at 60 °C for 4 hour. After hybridization, probes were washed out, and specimens were incubated with anti-DIG-AP antibody (Roche). Signal detection was carried out as described previously17 (link).

Omotezako T., Matsuo M., Onuma T.A, & Nishida H. (2017). DNA interference-mediated screening of maternal factors in the chordate Oikopleura dioica. Scientific Reports, 7, 44226.

+ Open protocol

+ Expand

Whole-mount in situ Hybridization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-mount in situ hybridization was performed as described previously (Estermann et al., 2020 (link)). Briefly urogenital systems were fixed overnight in 4% PFA in DEPC-PBS. After methanol dehydration and rehydration to PBTX (PBS+0.1% Triton X-1000), tissues were permeabilized in proteinase K 10 mg/ml for up to 2 hours. Tissues were briefly re-fixed and placed into pre-hybridization solution overnight at 65°C. TOX3 (Estermann et al., 2020 (link)), AMH (Lambeth et al., 2015 (link)) and aromatase (Hirst et al., 2017 (link)) antisense probes were added to pre-hybridized tissues (∼7.5 µl/tube) and hybridization was carried out overnight at 65°C. Tissues were then subjected to stringency washes, blocked in TBTX/BSA/sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). After extensive washing in TBTX, tissues were exposed to BCIP/NBT color reaction at room temperature for up to 3 h. Color reaction was stopped at the same time for each gene by rinsing in NTMT buffer, TBTX, PBTX, PBS and imaging. To examine tissue sections, samples were overstained for 2 days, cryoprotected in PBS plus 30% sucrose, snap frozen in OCT and cryosectioned (10 µm).

Estermann M.A., Major A.T, & Smith C.A. (2023). DMRT1-mediated regulation of TOX3 modulates expansion of the gonadal steroidogenic cell lineage in the chicken embryo. Development (Cambridge, England), 150(5), dev201466.

+ Open protocol

+ Expand

Comprehensive Retinal Cell Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following digoxigenin (DIG)-labelled riboprobes were used for colorimetric in situ hybridisations: neurod (Blader et al., 1997 (link)), crx (Liu et al., 2001 (link)), rx1, rx2 (Chuang et al., 1999 (link)), nrl (Nelson et al., 2008 (link)), nr2e3 (Chen et al., 2005 (link)), rod α-transducin (gnat1) and cone α-transducin (gnat2).
WISH on 6 dpf larvae was performed according to standard protocols (Thisse and Thisse, 2008 (link)). BM purple (Roche) was used as substrate.
Adult eyes or 6 dpf larvae were harvested and 10 µm cryosections prepared as described (Laranjeiro et al., 2013 (link)). In situ hybridisation on sections was performed as previously described (Schaeren-Wiemers and Gerfin-Moser, 1993 (link)) with the following modifications: blocking was performed with 10% goat serum in buffer B1; incubation with anti-DIG-AP antibody (Roche, 11093274910; 1:5000) was performed overnight at 4°C; to perform the colour reaction, BCIP/NBT (Vector Laboratories) in buffer B3/0.1% Tween 20 was used. All sections were stained with DAPI to aid identification of the retinal cell layers.

Laranjeiro R, & Whitmore D. (2014). Transcription factors involved in retinogenesis are co-opted by the circadian clock following photoreceptor differentiation. Development (Cambridge, England), 141(13), 2644-2656.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!