Megashortscript t7 transcription kit

We used the online software (MIT CRISPR Design Tool: http://crispr.mit.edu) to design sgRNAs targeting common sequence of pig and cow PDX1 gene. The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study are shown as follow: sgRNA1, 5′-TCGTACGGGGAGATGTCCGGGGG-3′; gRNA2. 5′-TCACGCGTGGAAAGGCCAGTGGG-3′. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL). To prepare sgRNA mRNA, the purified PCR product was in vitro transcribed by MEGAshortscript T7 Transcription Kit (Invitrogen) following the manufacturer’s instruction. Prepared RNAs were purified using MEGAclear Kit Purification Transcription Reactions (Ambion) and dissolved in water for embryo transfer (Sigma).

The gRNAs used in this work were either synthesised by Biomers (Ulm, Germany) (synthetic gRNA, without 5’-triphosphate) or in vitro transcribed using the MEGAshortscript™ T7 Transcription Kit (Invitrogen) (transcribed gRNA, with 5’-triphosphate). Oligonucleotides containing the sequence of the gRNA gND7(506) (GGGAUAUAAAUACGAUGUAAAUAACCUGUAGUAUAGUUAGUGUAUAUAGUGAAA) and a T7 promoter were annealed to make partially single-stranded templates. Following the manufacturer guidelines, the templates were added to the reaction to a final concentration of 200 nM, followed by nuclease-free water, nucleotide solutions, reaction buffer and T7 Enzyme mix, and incubated at 37°C for 4 h. After transcription, the reaction was mixed with a gel loading buffer and loaded in a 7 M urea–PAGE. The band of RNA was visualised in a TCL place using the U.V. shadowing method, cut from the gel and eluted in gel elution buffer (0.5 M ammonium acetate, 1 mM EDTA, 0.2% SDS) at 37°C, overnight. After elution, the RNA was precipitated with isopropanol and resuspended in nuclease-free water.

We created CRISPR indel mutation within the CDS sequence of Zeus by following the methods outlined in these two studies [38 (link),39 (link)]. Briefly, two guide RNAs primers (gRNAs, gs17F and gs18F) were designed by using the FlyCRISPR Optimal Target Finder [40 (link)]. We amplified the gDNAs by combining the universal reverse primer sgRNA_R (Phusion™ High-Fidelity DNA Polymerase (2 U/µL), Catalog number: F-530XL) and synthesized the gRNAs using the Invitrogen™ MEGAshortscript™ T7 Transcription Kit (Catalog No. AM1354). Using a microinjector, we microinjected the two gRNAs (~300 ng/μL each) together with Cas9 protein (500 ng/μL, PNA BIO INC, #CP01) into preblastodermDrosophila melanogaster embryos (BDSC #25710; P{y[+t7.7] = nos-phiC31\int.NLS}X, y[1] sc[1] v[1] sev[21]; P{y[+t7.7] = CaryP}attP2). High-Resolution Melting Analysis (HRMA) was used to screen the potential T0 positive mutants. Small frameshift deletions were confirmed through Sanger sequencing and created early stop codons in the transcribed genes.
gs15F:5’-GAAATTAATACGACTCACTATAGGCTGCTGGGGACTCATTACGTTTAAGAGCTATGCTGGAA-3’;
sgRNA_R:5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’;
hrma_F: CCAAGCATCCATCTGTTTAATGGG
hrma_R: CAGGATAGGCCAGCTCGATG

The sgRNA pool for Cas9-based ribosomal depletion in Salmonella was generated according to Prezza et al. (21 (link)). Briefly, a double-stranded DNA (dsDNA) template for in vitro transcription was generated with the oligonucleotide pool composed of 797 sequences targeting rRNA of Salmonella (JVO-21893 [Table S1F]) as well as the fill-in reaction oligonucleotide (JVO-21894 [Table S1F]) using KAPA HiFi HotStart ReadyMix (Roche). After column-based cleanup and quality control on Nanodrop and the Bioanalyzer DNA 1000 kit (Agilent), the sgRNA pool was generated by in vitro transcription using MEGAshortscript T7 transcription kit (Invitrogen). The final pool, consisting of 797 sgRNAs, was purified using the Monarch RNA cleanup kit (500 μg; New England BioLabs [NEB]). sgRNA quality control was performed with Qubit and the Bioanalyzer RNA 6000 Pico kit (Agilent).

We designed sgRNA molecules targeting four different zebrafish genes (smad6a, tprkb, pls3 and slc2a10) with CRISPRdirect software (http://crispr.dbcls.jp/) (Naito et al., 2015 (link)). For in vitro transcription, we synthetized gBlocks with the following structure (IDT, gBlock): 5′-CCGCTAGCTAATACGACTCACTATA-GG-N₁₈-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3′, where the two guanines in bold fulfill the T7 polymerase promoter requirement and N₁₈ represents the last 18 nucleotides of the protospacer sequence. Specific gBlock sequences for the four targets are listed in Table S7. Lyophilized gBlock molecules were dissolved in nuclease-free water at a concentration of 10 ng/µl and 4 µl was used as an input for in vitro transcription, using the MEGAshortscript™ T7 Transcription Kit (Invitrogen, cat. no. AM1354). We followed the general guidelines of the manufacturer except for the duration of the incubation step at 37°C, which was carried out overnight to obtain a maximum yield. The transcription reaction was purified using the MEGAclear™ Kit (Life Technologies, cat. no. AM1908), following the manufacturer's instructions. Quantity and integrity of the RNA was determined using, respectively, the DropSense96 device (Trinean) and the Experion microfluidic capillary electrophoresis system (Bio-Rad). The RNA was aliquoted and stored at −80°C.