Histological experiments were conceived and carried out as previously described (Shi et al., 2020 (link); Li et al., 2023 (link); Peng et al., 2023 (link)). Briefly, tracheal and left lung samples were isolated from experimental groups (control, asthma, dexamethasone and vandetanib). Then the isolated specimens were fixed in 4% paraformaldehyde (PFA) for 12 h at room temperature. Standard histological protocols were employed by Servicebio (Wuhan, China) to perform routine staining experiments such as hematoxylin and eosin (H&E) staining and periodic acid-Schiff (PAS) staining. The bright-field photographs of stained sections were labeled and analyzed. The PAS-positive cells in lung were counted and analyzed by using Fuji ImageJ.
Imagej
Manufactured by Fujifilm
Sourced in Japan, United States
ImageJ is an open-source image processing software developed for scientific image analysis. It provides a set of tools and functions for visualizing, editing, analyzing, and processing digital images and micrographs.
Automatically generated - may contain errors
Lab products found in correlation
Fluorobrite media, by Thermo Fisher Scientific (2 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Fc block, by BD (1 mentions)
Epifluorescence microscope, by Leica (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rnasin, by Promega (1 mentions)
Kimwipe, by Thermo Fisher Scientific (1 mentions)
2 methyl 2 butanol, by Merck Group (1 mentions)
Amersham imager 600, by GE Healthcare (1 mentions)
Rabbit anti bdnf monoclonal antibody, by Abcam (1 mentions)
Rabbit anti hif 1α polyclonal antibody, by Novus Biologicals (1 mentions)
Mouse monoclonal anti β actin antibody, by Merck Group (1 mentions)
Image gauge, by Fujifilm (1 mentions)
Supersignal west femto maximum sensitivity substrate, by Thermo Fisher Scientific (1 mentions)
Ecl solution, by Thermo Fisher Scientific (1 mentions)
A1 confocal system, by Nikon (1 mentions)
17 protocols using imagej
1
Histological analysis of asthma model
2
Quantifying Cellular Uptake of Liposomes and MPs
3
Tumor Tissue Analysis via Immunofluorescence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice were sacrificed and small tumor pieces (MC38-GFP; ∼2 × 3 × 1 mm) were excised. Samples were placed in 6 mL polypropylene tubes and blocked using Fc Block (PharMingen, San Diego, CA) at 10 μg/mL in 200 μL of PAB (phosphate-buffered saline, 0.1% sodium azide, 1% bovine serum albumin; Sigma Aldrich) for 15 minutes at 4°C. Antibodies (CD31-APC) were added directly to tubes and incubated for 2 hours at 4°C. Samples were washed twice by the addition of 4 mL PAB and rotated at 4°C for 30 minutes. After the final wash, samples were collected from the tubes and placed on glass slides with PAB. A coverslip was placed on top of the tumor and pressed down. Samples were viewed via fluorescence microscopy and digital images were acquired. Pseudo color was added to the digital images using ImageJ (Fuji).
4
Quantifying Microglial Activation and PKM2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemical staining was evaluated using a Leica epifluorescence microscope22 (link). Exposure conditions were kept constant for quantitative evaluation with (20 × objective) or (40 × objective) Iba1 and PKM2 staining. Photographs were analyzed using Fuji Image-J, applying the same brightness/contrast adjustments and threshold values for each marker. Signal intensities were normalized to values found in spinal cord sections from sham-operated rats22 (link). The intensity of immunoreactivity was measured as integrated density in regions of interest (ROI 0.3 mm2) in the ventral white matter at 0.8 cm distance anterior and posterior of the lesion center. Iba1 and PKM2 positive cells were counted in the same ROIs and within the lesion center (ROI 0.075 mm2). For the evaluation of cellular expression of PKM2, we calculated the percentages of Iba1/PKM2 double stained cells within the Iba1 positive cell population (microglia/macrophages), and of Iba1 positive cells that showed nuclear PKM2 staining.
5
Primer Extension Analysis of snRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Compound treatments were all done at cell densities of about 0.9x106 cells/mL. For each condition, 8-10x107 cells were used. Primer extension was done approximately as described in [47 (link)]; primers were: ACCCCACCTTCCAGATTC for SLRNA (KW01 or CZ6364) and TGGTTATTTCTCATTTAAGAGG (CZ6491) for U3 snRNA. Both primers and the ladder were radioactively 5'-end-labelled with [γ-32P]ATP. For extension, 10 μg of RNA was incubated for 5’ at 65° with 2 μL of dNTPs (10 mM) and roughly 200 000 counts per minute (cpm) of the corresponding primer. Afterwards, RNasin (Promega), SuperScript III Reverse Transcriptase (Thermo Fischer), DTT and buffer were added according to the manufacturers instructions. The mixture was incubated 60’ at 50°C and then inactivated 15’ at 70°C. The samples were run in 35 cm long 6% polyacrylamide gels, dried, and analysed by phosphorimaging. The images were analysed using Fuji / ImageJ.
6
Contact Angle Measurement of Thin Films
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Contact angle measurements were collected using the sessile drop technique and recorded using a UI-3370CP-M-GL Rev.2 camera equipped with a telecentric lens to remove the effect of field depth. 10 μL of probe liquid (UHP water, glycerol, formamide, propylene glycol, ethylene glycol or diiodomethane) was placed on the film surface and the static contact angle recorded and measured using the DropSnake plug-in on ImageJ (Fuji).
7
Quantifying Starter and Input Cells in Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The number of starter cells near the superior cerebellar peduncle and input cells for the entire brain were quantified on coronal sections captured at 300 µm intervals. Starter cells were identified as neurons with unambiguous co-distribution of mCherry and HA within the same neuronal cell body using the same methods as the CTB experiments. The number of RVdG-mCherry input cells for the different regions of the brain was quantified for those regions that had 50 or more input cells over the series of sections. The mCherry labeled cells were marked using a circular symbol on the captured images in Photoshop and the number of marked cells was quantified using ImageJ (Fuji).
8
Characterization of Fiber Morphology
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To carry out this test, Zeiss EVO equipment (Zeiss, Oberkochen, Germany) was used. Samples were observed at a 10 kV acceleration voltage and at a magnification between 500× and 2000×. A thin layer of gold was applied to the surface of the samples to give them conductive properties. The fiber size distribution was determined by considering 100 measurements of the fiber diameter using the digital tool FUJI ImageJ (Tokyo, Japan). At the same time, the porosity was measured using the same program, taking three measurements and calculating the average.
9
Western Blot Analysis of ERK1/2 Phosphorylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We collected RAW264.7 cells, placed the cells on ice in RIPA containing 1% PMSF for 30 min, and then used a BCA protein quantitative kit to measure the protein concentration. Protein of 20 μg was loaded onto 10% SDS-PAGE gels for separation, and then the separated proteins were electroblotted onto a nitrocellulose membrane at 2 h for 200 mA. The membrane was blocked with 5% bovine serum albumin (BSA) for 1 h at 4 °C and incubated with primary antibodies at 4 °C overnight. After washing with Tris-buffered saline containing 0.05% Tween-20 (0.05% TBST buffer), the membrane was incubated with HRP-conjugated secondary antibodies. Then, the membrane was washed with TBST and reacted with enhanced chemiluminescence (ECL) for protein band visualization. The intensities of the bands were analyzed by ImageJ (Fujifilm, Tokyo, Japan). The relative protein expression was calculated by normalization to GAPDH. The following primary antibodies were used: ERK1/2 (1 : 1000), p-ERK1/2 (1 : 1000) and GAPDH (1 : 1000).
10
Quantitative Bacterial Cell Imaging via FFT Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!