Sybr green master mix

Manufactured by Qiagen

Sourced in United States, Germany, Denmark, Canada, China, Spain, United Kingdom

The SYBR Green Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, which binds to double-stranded DNA, enabling the detection and quantification of DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SYBR Green (372 citations) SYBR Green Mix (45 citations) SYBR master mix (17 citations) SYBR Green-based qPCR master mixes (3 citations) SYBR Green Real‐Time PCR Master Mixes (2 citations) RT² SYBR Green qPCR Master Mixes (2 citations)

452 protocols using sybr green master mix

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight genes and one reference gene (HPRT1) selected as a result of PCR array analysis were tested by RT qPCR. 8 gene-speci c Primer Assays and SYBR Green Master Mix (SABiosciences, Frederick, MD, USA) were purchased and each PCR reaction mix was prepared by adding 12.5 µl SYBR Green Master Mix, 1 µl Primer and 2.2 µl cDNA sample and the total volume was set to 25µl.
PCR mixes were loaded into the Rotor-Gene RG-3000 instrument for ampli cation. Ampli cation was carried out at 95 ° C for 5 minutes with the rst denaturation step followed by 40 cycles of 94 ° C for 1 minute, 61 ° C for 40 seconds and 72 ° C for 1 minute. The cycling threshold (Ct) values obtained as a result of the RT qPCR primary assay were normalized with the HPRT1 gene and evaluated using REST 2009 (Relative Expression Software Tool V.2.0.13).

Demirci U., Orenay-Boyacioglu S., Kasap E., Gerçeker E., Bilgiç F., Yüceyar H., Yildirim H., Baykan A.R., Ellidokuz E.B, & Korkmaz M. (2023). Overexpressions of RHOA, CSNK1A1, DVL2, FZD8, and LRP5 genes enhance gastric cancer development in the presence of Helicobacter pylori. Arab journal of gastroenterology : the official publication of the Pan-Arab Association of Gastroenterology, 24(2).

+ Open protocol

+ Expand

Quantification of miRNA and mRNA expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was reverse transcribed using the miScript Reverse Transcription kit (Qiagen, Valencia, CA). Quantification of the ubiquitously expressed miRNA, U17a, was used as an internal control which expresses consistently in normoxia and hypoxia. A reaction mixture (20µl) containing the SYBR Green Master Mix (Qiagen), 2ng of cDNA template plus miScript Universal primer and miScript Primer Assay (miR specific primer for miR-181a) in a 96-well plate was used for real-time PCR using miScript SYBR Green PCR kit (Qiagen). The reactions were done in triplicate on the DNA engine Opticon 2 PCR amplification system (Bio-Rad, Hercules, CA). PCR conditions: an initial step at 95 °C for 10 min, followed by 40 cycles of amplification at 94 °C for 10 s, 55 °C for 30s, then 70°C for 30s. To determine the expression level of RGS16, total RNA was analyzed using the Reverse Transcription System (Bio-Rad) followed by real-time PCR with SYBR Green Master Mix (Qiagen). 18S and B2M were used as internal controls(21 (link);22 (link)). The primers for RGS16 and 18s have been previously published (23 (link);24 (link)). The primers for B2M were 5’-GTGGAGCATTCAGACTTGTCTT-3’ and 5’-GCGGCATCTTCAAACCTCC-3’, respectively. The data analysis was performed as previously described(23 (link);25 (link)).

Sun X., Charbonneau C., Wei L., Chen Q, & Terek R.M. (2015). miR-181a Targets RGS16 to Promote Chondrosarcoma Growth, Angiogenesis, and Metastasis. Molecular cancer research : MCR, 13(9), 1347-1357.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Plant Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qRT-PCR analysis was performed using the SYBR Green master mix (SABiosciences, Frederick, MD, USA) according to the manufacturer’s instructions. Complementary DNA synthesis was carried out using the Fermentas First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) on RNA from 28- to 55-day-old plants grown under normal light conditions. Complementary DNAs were diluted 20-fold prior to quantitative PCR experiments. The Touch 1000 platform (Bio-Rad Company, Beijing, China) was used for qRT-PCR experiments, and the data were analyzed using the Bio-Rad software version 1.5. We used glyceraldehyde-3-phosphate dehydrogenase C2 (GAPC2) or ACTIN2 (for monitoring gene expression in plants, including the wrky53 plants) as the internal reference gene for calculation of relative expression. Primers are listed in Supplementary Table S1. All determinations were conducted in three biological replicates.

Lin W., Huang D., Shi X., Deng B., Ren Y., Lin W, & Miao Y. (2019). H2O2 as a Feedback Signal on Dual-Located WHIRLY1 Associates with Leaf Senescence in Arabidopsis. Cells, 8(12), 1585.

+ Open protocol

+ Expand

Osteoclastogenesis Regulation by GDF11

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression levels of messenger RNA were measured by microarray analysis of mouse BMMs 24 h after stimulation in the presence of 100 ng ml⁻¹ M-CSF and 50 ng ml⁻¹ RANKL with or without 100 ng ml⁻¹ rGDF11. Total RNA was isolated using an RNeasy kit (Qiagen) according to the manufacturer's protocol. Microarray experiments were performed in triplicate using the Affymetrix Mouse Gene 1.0 ST Array. The robust multichip average method was used to normalize the gene expression raw data. We calculated the gene expression levels using Affymetrix Expression Console and Transcriptome Analysis Console 3.0 software. The threshold for differentially regulated transcripts was set as the fold change of 1.5 with a P value of <0.01.
For quantitative RT-PCR, cDNA was prepared from 2 μg RNA using a QuantiTec reverse transcription kit (Qiagen) and analysed with SYBR GreenMaster Mix (SABiosciences) in ABI7500 real-time PCR system (Applied Biosystems, Foster City, CA). The primers designed for each targeted gene are listed in Supplementary table 1. Relative expression was calculated using a 2^−ΔΔCt method by normalizing with Gapdh housekeeping gene expression and presented as fold increase relative to control.

Liu W., Zhou L., Zhou C., Zhang S., Jing J., Xie L., Sun N., Duan X., Jing W., Liang X., Zhao H., Ye L., Chen Q, & Yuan Q. (2016). GDF11 decreases bone mass by stimulating osteoclastogenesis and inhibiting osteoblast differentiation. Nature Communications, 7, 12794.

+ Open protocol

+ Expand

Wnt Signaling Gene Expression in Mouse Colon

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen samples of the distal colon from 6 mice per group, about 45 mg in size, were homogenized using pistils. RNA was extracted using the Illustra RNAspin Mini RNA isolation Kit (GE Healthcare, Buckinghamsire, UK) according to the manufacturer’s instructions. After RNA extraction, cDNA was synthesized from 1µg of total RNA using the RT2 First Strand Kit (SABioscience, Frederick, MD, USA) as described by the manufacturer. The cDNA was then used to detect the expression level of genes involved in Wnt signaling by qPCR using the RT2 Profiler PCR array system specific for the Wnt/β-catenin signaling pathway (Ref.: PAMM-043Z, SA Biosciences). SYBR Green Master Mix (SA Biosciences) was prepared and used according to the manufacturer’s instructions. Briefly, a master mix containing 1µg of cDNA was prepared, and 25 µL of the mix was added to each well of the PCR array. The qPCR was performed in a Chromo 4 thermal cycler (MJ Research, Bio-Rad, Hercules, CA, USA) under the following conditions: 1 cycle of 10 min at 95 °C, to activate the HotStart DNA polymerase, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. SYBR Green fluorescence was measured at every cycle.

Benito I., Encío I.J., Milagro F.I., Alfaro M., Martínez-Peñuela A., Barajas M, & Marzo F. (2021). Microencapsulated Bifidobacterium bifidum and Lactobacillus gasseri in Combination with Quercetin Inhibit Colorectal Cancer Development in ApcMin/+ Mice. International Journal of Molecular Sciences, 22(9), 4906.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from GFP+ and GFP, CD49f+ and CD49f–, control and cisplatin treated cells using RNeasy kit (Qiagen). For mRNA analysis, cDNA was synthesized from 1 ug of total RNA using the Superscript III kit (Invitrogen, Grand Island, NY). SYBR Green-based real time PCR was subsequently performed in triplicate using SYBR-Green master mix (SA Biosciences) on Applied Biosystems StepOnePlus real time PCR machine (Thermo). For analysis, the threshold cycle (Ct) values for each gene were normalized to expression levels of β-actin. The primers used were:

Wiechert A., Saygin C., Thiagarajan P.S., Rao V.S., Hale J.S., Gupta N., Hitomi M., Nagaraj A.B., DiFeo A., Lathia J.D, & Reizes O. (2016). Cisplatin induces stemness in ovarian cancer. Oncotarget, 7(21), 30511-30522.

+ Open protocol

+ Expand

Quantifying Gene Expression in Cancer Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from CSCs and non-CSCs, CD55 knockdown and overexpressing cells and their respective controls, saracatinib-treated cells, and LCK-overexpressing cells using the RNeasy kit (QIAGEN). For mRNA analysis, cDNA was synthesized from 1 μg total RNA using the Superscript III kit (Invitrogen). SYBR Green-based real-time PCR was subsequently performed in triplicate using SYBR-Green master mix (SA Biosciences) on an Applied Biosystems StepOnePlus real-time PCR machine (Thermo Fisher Scientific). For analysis, the threshold cycle (Ct) values for each gene were normalized to expression levels of β-actin. The primers used are listed in Table 1.

Saygin C., Wiechert A., Rao V.S., Alluri R., Connor E., Thiagarajan P.S., Hale J.S., Li Y., Chumakova A., Jarrar A., Parker Y., Lindner D.J., Nagaraj A.B., Kim J.J., DiFeo A., Abdul-Karim F.W., Michener C., Rose P.G., DeBernardo R., Mahdi H., McCrae K.R., Lin F., Lathia J.D, & Reizes O. (2017). CD55 regulates self-renewal and cisplatin resistance in endometrioid tumors. The Journal of Experimental Medicine, 214(9), 2715-2732.

+ Open protocol

+ Expand

Quantitative Analysis of CX3CR1 and Inflammatory Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Total mRNA (1 μg) was reverse transcribed using cDNA RT Kits (Thermo, Rockford, IL, USA) according to the manufacturer’s manual. Real-time PCR was performed using SYBR Green Master Mix (SABiosciences, Frederick, MD, USA) on an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA, USA). The cycle threshold (Ct) values were analyzed by using the comparative Ct (ΔΔCt) method. The amount of target was obtained by normalizing to the endogenous reference (GAPDH) and shown as the relative to the control (non-treated cells). The following oligonucleotides were used as primers: human CX3CR1 (forward, 5′- GACGGTTGCATTTAGCCATT -3′; reverse, 5′- TGCTCAGAACACTTCCATGC -3′), mouse CX3CR1 (forward, 5′- TGAGTGACTGGCACTTCCTG -3′; reverse, 5′- CGAGGACCACCAACAGATTT -3′), rat CX3CR1 (forward, 5′- TCACCATGCCTACCTCCTTC -3′; reverse, 5′- ACCAGACCGAACGTGAAGAC -3′), mouse YY1 (forward, 5′- ACCTGGCATTGACCTCTCAG -3′; reverse, 5′- TTCTCATGGCCGAGTTATCC -3′), GAPDH (forward, 5′- TGCACCACCAACTGCTTAGC -3′; reverse, 5′- GGCATGGACTGTGGTCATGAG -3′). The primers for TNF-α, IL-1β, LI-6, CXCL10 were purchased from SABiosciences.

Duan M., Yao H., Cai Y., Liao K., Seth P, & Buch S. (2014). HIV-1 Tat disrupts CX3CL1-CX3CR1 axis in microglia via the NF-κB-YY1 pathway. Current HIV research, 12(3), 189-200.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was collected from cells using an RNeasy kit (Qiagen, 74004). RNA concentrations were measured using a NanoDrop spectrophotometer, and cDNA was synthesized with qScript synthesis reagent (Quanta Biosciences, 95048). qPCR was run with the primers shown in Table S2 using SYBR-Green Mastermix (SA Biosciences, 4385610) and an Applied Biosystems QuantStudio 3. During analysis, threshold cycle numbers were normalized to GAPDH or Actin levels.

Lauko A., Volovetz J., Turaga S.M., Bayik D., Silver D.J., Mitchell K., Mulkearns-Hubert E.E., Watson D.C., Desai K., Midha M., Hao J., McCortney K., Steffens A., Naik U., Ahluwalia M.S., Bao S., Horbinski C., Yu J.S, & Lathia J.D. (2022). SerpinB3 drives cancer stem cell survival in glioblastoma. Cell reports, 40(11), 111348.

+ Open protocol

+ Expand

Quantifying IL-1β Expression in Eosinophils

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified PBEos were cultured 1 hour +/− MβCD or MβCD+Chol, then, stimulated with media +/−1 nM IL-5 for 4 hours. Total RNA was extracted (RNeasy Mini Kit [Qiagen; Valencia, CA, USA]), and the reverse transcription reaction was performed using the Superscript III system (Invitrogen/Life Technologies; Grand Island, NY, USA). mRNA expression was determined by qPCR using SYBR Green Master Mix (SABiosciences; Frederick, MD, USA). Human IL-1β specific primers (forward primer: TCGAGGCACAAGGCACAACAGG; reverse primer: CCATGGCTGCTTCAGACACTTGAGC) were used to quantify IL-1β mRNA levels, using the reference gene, β-glucuronidase to normalize. Data are expressed as fold change using the comparative cycle threshold (ΔΔCT) method as described previously [45] (link), and values given are fold change (2-ΔΔCt) compared to the level in media-pretreated, non-stimulated eosinophils, which was set at 1 (n = 5).

Burnham M.E., Esnault S., Roti Roti E.C., Bates M.E., Bertics P.J, & Denlinger L.C. (2014). Cholesterol Selectively Regulates IL-5 Induced Mitogen Activated Protein Kinase Signaling in Human Eosinophils. PLoS ONE, 9(8), e103122.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!