Western blotting was performed as described previously (Shi et al., 2015 (link)). Specifically, proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. Antibodies for detecting protein were diluted at 1:1,000 for anti-METTL3 antibody (Abcam), anti-FTO antibody (Abcam), an anti-NRIP1 antibody (Abcam), an anti-METTL3 antibody (Abcam), an anti-NRIP1 antibody (Abcam), and 1:5,000 for anti-β-ACTIN antibody (Abcam). The horseradish peroxidase–labeled secondary antibody (Abcam) was diluted at 1:10,000 and detected with enhanced chemiluminescence NcmECL Ultra kit (NCM Biotech, China).
Anti mettl3 antibody
Manufactured by Abcam
Sourced in United States, United Kingdom
The Anti-METTL3 antibody is a research tool used to detect and study the METTL3 protein, which is an enzyme involved in the N6-methyladenosine (m6A) modification of RNA. This antibody can be used in various techniques, such as Western blotting, immunohistochemistry, and immunoprecipitation, to identify and localize the METTL3 protein in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Anti fto antibody, by Abcam (3 mentions)
Anti β actin antibody, by Abcam (2 mentions)
Anti β actin antibody, by Cell Signaling Technology (2 mentions)
Anti m6a antibody, by Synaptic Systems (2 mentions)
Anti ythdf2 antibody, by Proteintech (2 mentions)
Anti β actin antibody, by Proteintech (2 mentions)
Anti wtap antibody, by Proteintech (2 mentions)
Anti stat1 antibody, by Abcam (2 mentions)
Magna chip a g kit, by Merck Group (2 mentions)
Dynabeads co immunoprecipitation kit, by Thermo Fisher Scientific (2 mentions)
Anti igf2bp1 antibody, by Abcam (2 mentions)
Anti m6a antibody, by Abcam (2 mentions)
Magna rip kit, by Merck Group (2 mentions)
Rabbit anti mouse igg, by Abcam (2 mentions)
Anti nrip1 antibody, by Abcam (1 mentions)
Horseradish peroxidase labeled secondary antibody, by Abcam (1 mentions)
Chemiluminescence system, by Bio-Rad (1 mentions)
Protease inhibitor, by Merck Group (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Anti pten antibody, by Abcam (1 mentions)
24 protocols using anti mettl3 antibody
1
Western Blotting of Epigenetic Regulators
2
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular proteins were lysed by RIPA buffer containing protease inhibitors (Sigma, USA). The protein extractions were harvested and quantified by bicinchoninic acid (BCA) analysis (Beyotime, China). Protein extractions were separated by 10% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). After the incubation with a high affinity anti-METTL3 antibody (1:1000, Abcam, USA), anti-DGCR8 antibody (1:1000, Abcam, USA), anti-PTEN antibody (1:1000, Abcam, USA), anti-β-actin antibody (1:1000, Cell Signaling Technology, USA) or anti-GAPDH antibody (1:1000, Cell Signaling Technology, USA), the membranes were then incubated with peroxidase (HRP)-conjugated secondary antibody (1:1000, Cell Signaling Technology, USA). After washes, signals were detected using a chemiluminescence system (Bio-Rad, USA) and analyzed using Image Lab Software.
3
Protein Expression and Modification Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed as described previously [30 (link)]. The anti-METTL3 antibody (#ab195352) and anti-Ki67 (#ab156956) were purchased from Abcam. The anti-IFIT2 antibody (#DF8962) was purchased from Affbiotech. The anti-H3K4me3 antibody (#39160) was purchased from Active Motif. The anti-β-actin antibody (#4970) and anti-rabbit IgG, HRP-linked antibody (#7071) was purchased from Cell Signaling Technology. The anti-m6A antibody (#202003) was purchased from Synaptic Systems. The anti-histone H3 antibody (#ab21054) was purchased from Abcam. The anti-YTHDF2 antibody (#24744-1-AP) was purchased from Proteintech.
4
ZFAS1 Interaction with miR-647 and Associated Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the interaction between ZFAS1 and miR-647, cells were transfected with pCMV-MS2, pCMV-ZFAS1-MS2, pCMV-ZFAS1-mut-MS2 and pCMV-FLAG-MS2. Forty-eight hours later, cells were used to perform RIP assay using 5 μg anti-FLAG antibody (Sigma) and the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, Bedford, MA) according to the manufacturer’s instructions. To detect the interaction between METTL3 or AGO2 and ZFAS1, RIP assay was carried out by using 5 μg anti-METTL3 antibody (Abcam) or anti-AGO2 antibody (Abcam) and the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit. IgG was taken as a negative control. The RNA fraction isolated and purified by RIP assay was then examined by RT-PCR.
5
Immunohistochemical Analysis of NCALD and METTL3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues were fixation with 4% paraformaldehyde, embedded in paraffin and then subjected to standard dewaxing and rehydration. The sections were incubated in citric acid buffer (pH 6.0) for 15 min for antigen retrieval, followed by incubation for 10 min with 3% H2O2 solution to inactivate endogenous enzymatic activity. The sections were then incubated with anti-NCALD antibody (ProteinTech Group, Inc.; cat. no. 12925-1-AP; 1:200) or anti-METTL3 antibody (Abcam; cat. no. ab195352; 1:500) for 1 h at 25°C followed by Elivision plus Polyer HRP (mouse/rabbit) immunohistochemistry kit (Maxim Biotech, Inc.; cat. no. KIT-9903; 1:1,000) for 30 min at 20°C. The results were evaluated by two pathologists who were blinded to the patients. Immunoreactivity was scored using the H-score system (33 (link)) ranging from 0 to 4. The staining intensity ranged from 0-3, thus giving a range from 0-12. Patients were divided into a low-expression group (score <4) or a high-expression group (score ≥4).
6
Immunohistochemical Analysis of METTL3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The paraffin-embedded sections (4 μm) were dewaxed, blocked with serum for 1 hour, and then stained with anti-METTL3 antibody (cat# ab195352, Abcam, Cambridge, UK) for 2 hours. Subsequently, sections were incubated with a goat anti-rabbit immunoglobulin G (IgG)/horseradish peroxidase (HRP) antibody for 30 minutes and stained with the diaminobenzidine (DAB) solution.
7
Investigating the Role of m6A Modification in Diabetic Nephropathy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were used: transfection was performed with Lipofectamine RNAiMAX Reagent (Invitrogen Life Technologies, 13, 778-030) according to the manufacturer’s protocol. The following antibodies were used: anti-β-actin antibody (Proteintech, 66009-1-Ig); anti-m6A antibody (Synaptic Systems, 202,003); anti-METTL3 antibody (Abcam, Ab195352, ZEN-BIOSCIENCE [382,974]); anti-METTL14 antibody (Cell Signaling Technology, 51, 104); anti-WTAP antibody (Proteintech, 10200-1-AP); anti-KIAA1429 antibody (SAB, 29, 774); anti-TIMP2 antibody (Abcam, ab180630); anti-NF-κB p65 antibody (Cell Signaling Technology, 8242); anti-phospho-NF-κB p65 antibody (Cell Signaling Technology, 3033); anti-cleaved caspase3 antibody (Abcam, Ab2302); anti-NOTCH3 antibody (Proteintech, 55114-1-AP); anti-NOTCH4 antibody (Affinity, DF13597); anti-WT-1 antibody (Abcam, ab267377); anti-nephrin antibody (Abcam, ab216341); anti-podocin antibody (Abcam, ab181143); anti-MMP2 antibody (Proteintech, 10373-2-AP); anti-MT1-MMP antibody (Proteintech, 14552-1-AP); anti-IGF2BP2 antibody (Proteintech, 11601-1-AP); anti-col-Ⅳ antibody (Abcam, ab6586); and anti-fibronectin antibody (Abcam, ab6586). STZ was purchased from Sigma Chemical Company (MO, USA). The PAS kits were obtained from Solarbio (Beijing, China). Mouse Albumin ELISA Kit was obtained from Abcam Biotechnology (Cambridge, UK).
8
Immunofluorescence Staining of METTL3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa, A549 and 293A cells were seeded in 4-well chamber slides (Lap-Tek, NY, USA). Cells were fixed with 4% paraformaldehyde in PBS for 10 min and permeabilized with 0.5% Triton X-100 in PBS for 15 min. The cells were then washed with PBS and blocked with 5% goat serum and 0.1% bovine serum albumin for 1 h. The samples were then incubated with an anti-METTL3 antibody (Abcam) at 4°C for 12 h. After washing the slides with PBS, Alexa Fluor 488-conjugated goat antibodies against rabbit IgG (Thermo Fisher Scientific) were used as secondary antibodies. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were captured using a Zeiss LSM 880 confocal laser-scanning microscope (Carl Zeiss, oberkochen, germany), and the signal intensities of the images were analyzed using the LSM software ZEN (Carl Zeiss).
9
Immunofluorescence Localization of RNA Methylation Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U87MG and U118MG glioblastoma cell lines were adhered onto poly-L-lysine glass slides and fixed for 10 min at room temperature in 4% paraformaldehyde. Cells were washed twice in PBS, permeabilized for 10 min with PBS containing 0.1% Triton-X-100 and incubated for 1 h with PBS containing 0.5% BSA. Cells were then incubated o/n at 4 °C with anti-ADAR1 antibody (Bethyl) which was diluted 1:500 and anti-METTL3 antibody (Abcam) which was diluted 1:200 and anti-METTL14 antibody (Bethyl) diluted 1:100. After washing, secondary antibody (alexa Fluor 488 Invitrogen) was added for 1 h at room temperature. Slides were washed and mounted in 50% glycerol in PBS. Hoechst 33342 (Sigma Aldrich) was used to counterstain nuclei. Confocal imaging was performed on an Olympus Fluoview FV1000 confocal microscope equipped with FV10-ASW version 4.1a software.
10
Chromatin Immunoprecipitation (ChIP) Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assay was performed with Magna ChIP™ A/G kit (Millipore, USA) according to manufacturer's instruction. In brief, 1 × 107 cells fixed with formaldehyde were collected and subject to 500 μl lysis buffer. Then lysate was sonicated, and then the supernatant was diluted and fully mixed with Protein A/G magnetic beads. Then 5 μg of anti‐Mettl3 antibody (Abcam, USA), anti‐STAT1 antibody (Abcam, USA), or IgG was added respectively, followed by incubation at 4°C overnight. The next day, after washing, the mixture was incubated with elution buffer at 62°C for 2 h and then at 95°C for 10 min. Then DNA was purified from the elution and was subject to RT‐qPCR with primers: IL‐6 promoter (forward: 5′‐GTTCCTGGTTTTCTGTCCACCT‐3′; reverse: 5′‐ATGTACACTAAGTCCACCCATG‐3′). Relative enrichment was normalized to the input: %Input = 1/10 × 2Ct [IP] – Ct [input].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!