Iq5 optical system software version 1

After sacrifice, mouse quadriceps samples (approx. 30 mg) were immediately frozen in liquid nitrogen for subsequent analysis. Total RNA was extracted from the muscle using QIAzol Lysis Reagent and Tissue Lyser instrument (Qiagen Italia, Milano, Italy), according to the manufacturer’s instructions. The cDNA was synthesized by using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Milano, Italy), starting from 1 μg of total RNA, and was used as a template for qPCR analysis: reactions were performed in an iQ5 Real-Time PCR detection system (Bio-Rad Laboratories, Milano, Italy) as described [33 (link)]. The mouse-specific primers were designed using Beacon Designer 2.0 software (Bio-Rad Laboratories, Milano, Italy), and their sequences are listed in Table S1 (Supplementary Materials). Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad Laboratories, Milano, Italy) based on the 2^−ΔΔCt method [34 (link)]. Values for mouse genes were normalized on hypoxanthine-guanine phosphoribosyltransferase-1 mRNA expression. To verify the purity of the products, a melting curve was produced after each run. The dissociation curve for each amplification was analyzed to confirm the absence of nonspecific PCR products.

RNA extraction from MNCs from CCS or healthy donor was performed using the RNeasy Mini Kit (Qiagen, Milan, Italy) and quantified using a NanoDrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). The cDNA was synthesized by using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Milan, Italy) starting from 1 μg of total RNA. PCR primers were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer) and GGCCAGGTGCATGTATTCCT (reverse primer); PGC1-alpha primers sequences were: CTGTGTCACCACCCAAATCCTTAT (forward primer) and TGTTCGAGAAAAGGACCTTGA (reverse primer); Sirt6 human primers sequences were: CCTCCTCCGCTTCCTGGTC (forward primer) and GTCTTACACTTGGCACATTCTTCC (reverse primer). Quantitative real-time PCR (qPCR) was performed in an iQ5 real-time PCR detection system (Bio-Rad Laboratories) using 2× iQ Custom Sybr Green Supermix (Bio-Rad Laboratories). Values were normalized on mRNA expression of human β-actin and HPRT (reference genes). Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad Laboratories) based on the 2−ΔΔCt method. The dissociation curve for each amplification was analyzed to confirm the absence of nonspecific PCR products.

OVL2 and SHL2 H9c2 cells were incubated with or without 10 µM ABA, BT-11, and AR-42 for 4 h after being serum-starved for 18 h. Total RNA was extracted from cardiomyocytes using RNeasy Micro Kit (Qiagen, Milan, Italy), according to the manufacturer’s instructions. cDNA was obtained from 1 μg of total RNA by using iScript cDNA Synthesis Kit (Bio-Rad, Milan, Italy) and qPCR reactions were performed in an iQ5 Real-Time PCR detection system (Bio-Rad, Milan, Italy) as described in [4 (link)]. Specific rat primers were designed using Beacon Designer 2.0 software (Bio-Rad, Milan, Italy), and their sequences are listed in Table S7.
Values were normalized on hypoxanthine-guanine phosphoribosyltransferase-1 (Hprt1) mRNA expression. Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 [Bio-Rad Laboratories, Milan, Italy] by 2^−△△Ct method [8 (link)]. The dissociation curve for each cycle of amplification was analyzed to confirm the absence of nonspecific PCR products.

H9c2 cells were serum-starved for 12 h, then treated or not with 100 nM ABA for 4 h. Total RNA was extracted from cells using the RNeasy Micro Kit (Qiagen, Milan, Italy), according to the manufacturer’s instructions. The cDNA was synthesized by using iScript cDNA Synthesis Kit (Bio-Rad, Milan, Italy), starting from 1 μg of total RNA, and was used as template for qPCR analysis: reactions were performed in an iQ5 Real-Time PCR detection system (Bio-Rad, Milan, Italy) as described [15 (link)]. The rat-specific primers were designed using Beacon Designer 2.0 software (Bio-Rad, Milan, Italy), and their sequences are listed in Table S1. Statistical analysis of the qPCR was performed using the iQ5 Optical System Software version 1.0 (Bio-Rad Laboratories, Milan, Italy) based on the 2^−ΔΔCt method [15 (link)]. Values for rat genes were normalized on hypoxanthine-guanine phosphoribosyltransferase-1 mRNA expression. To verify the purity of the products, a melting curve was produced after each run. The dissociation curve for each amplification was analyzed to confirm absence of non-specific PCR products.