Total RNA was extracted using TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The RNA samples were stored at −80°C until use. The extracted RNA was reverse-transcribed into cDNA using the First-Strand cDNA Synthesis kit (Qiagen, Inc.) according to the manufacturer's protocols. Each cDNA sample was added to a 20 µl reaction volume containing an appropriate primer set and SYBR green supermix. Triplicates of all samples were analyzed. The SYBR Real-Time PCR kit (Qiagen, Inc.) was used under the following conditions according to the manufacturer's protocols: 95°C for 2 min, followed by 40 cycles of 95°C for 5 sec and 60°C for 10 sec. Relative expression was normalized to GAPDH and calculated according to the 2−∆∆Cq method (19 (link)). In the present study, the following primers were used: GAPDH forward primer GCCACATCGCTCAGACACCAT, GAPDH reverse primer: CCCATACGACTGCAAAGACCC, Human FSCN1 forward: GACGAGCTCTTTGCTCTGGA, Human FSCN1 reverse: TCGGTCTCCTCGTCCTGATT, Human FSCN2 forward: TGGAGGAGAGTCACCCACAG, Human FSCN2 reverse: TCAGGAAGGTCTCGTGGTCT, Human FSCN3 forward: GCTTCGTTCAGCCAATGGCTAC, Human FSCN3 reverse: ATCCTGCCACAGTTCCAGTGCA. The QuantiTect SYBR Green PCR kit (Qiagen, Inc.) was used to perform real-time quantitative PCR. GAPDH was used as an internal control. Experiments were replicated three times.
First strand cdna synthesis kit
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, Italy
The First Strand cDNA Synthesis Kit is a laboratory equipment product designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit provides the necessary reagents and protocols for the efficient conversion of RNA into single-stranded cDNA, which can then be used for various downstream applications, such as PCR and gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (10 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr real time pcr kit, by Qiagen (5 mentions)
Rneasy kit, by Qiagen (4 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Rt2 real time sybr green rox pcr master mix, by Qiagen (4 mentions)
Nd 1000, by Thermo Fisher Scientific (3 mentions)
Lightcycler, by Roche (3 mentions)
Abi sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Abi 7500 fast block, by Thermo Fisher Scientific (3 mentions)
Mirneasy mini kit, by Qiagen (3 mentions)
Rna extraction kit, by Qiagen (3 mentions)
Rt2 profiler pcr array, by Qiagen (3 mentions)
Rnaeasy mini kit, by Qiagen (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Human dna damage pcr array, by Qiagen (3 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Tri reagent, by Merck Group (2 mentions)
72 protocols using first strand cdna synthesis kit
1
Quantification of Fascin Family Genes
2
Quantification of Osteogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRI reagent (1 mL; Sigma-Aldrich) and quantified by spectrophotometry (ND-1000, Nanodrop Technologies, Wilmington, DE, USA). cDNA was synthesized from 1 μg of total RNA with a first strand cDNA synthesis kit (Qiagen, Hilden, Germany) in the presence of random hexamers in a final volume of 20 μl at 25 °C for 10 min, followed by 42 °C for 15 min and 95 °C for 3 min. PCR SYBR Green kit (Qiagen N.V., Hilden, Germany) was used to quantify mRNA expression levels. Primers for PCR were synthesized with Oligo software. RUNX2 (Forward 5′CGG-GAA-TGA-TGA-GAA-CTA-CTC3′ Reverse 5′CGG-TCA-GAG-AAC-AAA-CTA-GGT3′), OSTERIX (Forward 5′GTA-CGG-CAA-GGC-TTC-GCA-TCT-GA3′ Reverse 5′TCA-AGT-GGT-CGC-TTC-GGG-TAA-AG3′), OSTEOCALCIN (Forward 5′TCT-GAG-TCT-GAC-AAA-GCC-TTC-ATG3′ Reverse 5′TGG-GTA-GGG-GGC-T GG-GGC-TCC3′), and 18-S (Forward 5′GTA-ACC-CGT-TGA-ACC-CCA-TT3′Reverse 5′CCA-TCC-AAT-CGG-TAG-TAG-CG3′). Primers for HEY2 (Forward: 5′TCC-AAT-GCT-CAT-AAA-GTC-CGT3′ and Reverse: 5′ TCT-GCA-AAT-GAC-AGT-GGA-TCA3′) were purchased from IDT Integrated DNA Technologies (Leuven, Belgium). The expression level of these genes was evaluated by quantitative RT-PCR (Light cycler, Roche Diagnostics, Basel, Switzerland) with the 2−ΔΔCt method, using ribosomal 18 S RNA as housekeeping control.
3
Circadian Gene Expression in Mouse Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lungs of the mice exposed to WPS or e-cig vapors containing nicotine or PG alone were snap frozen and stored at -80°C. One hundred milligrams of frozen lung tissues were homogenized in Trizol and total RNA was isolated using the RNeasy kit (Qiagen), according to the manufacturer’s instructions. The extracted RNA was quantitated by absorbance using a nanodrop spectrophotometer (Nanodrop One; Thermo Scientific) and was followed immediately by cDNA synthesis using the First Strand cDNA synthesis kit (Qiagen). One μg of total RNA was used for the initial reaction. cDNA was stored at -20°C and was used for quantitative real-time polymerase chain reaction (qPCR). For normalization 18S ribosomal RNA was used as a control. The CT value for 18S ribosomal RNA was subtracted from the CT value for the gene of interest to obtain a delta CT (ΔCT) value. The relative fold-change for each gene was calculated using the 2-ΔΔCt method. The mouse circadian clock genes primer pairs used are listed in Table 1 .
4
Quantifying COL27A1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This study utilized the TRIzol reagent (Invitrogen, USA) to extract total blood RNA in accordance with specific protocols. By adopting the First Strand cDNA Synthesis Kit (Qiagen, Germany), we prepared cDNA through reverse transcription. Thereafter, the ABI SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA) was adopted for the RT-PCR procedure, with GAPDH being the endogenous control. The primer sequences used in this study are shown as follows: COL27A1: GAGGTCCTCACTTCCAGGAG (forward) and AGGACGCTGAACGTCACTAT (reverse), and GAPDH: ACCCAGAAGACTGTGGATGG (forward) and TCAGCTCAGGGATGACCTTG (reverse). The 2−ΔΔCt approach was utilized to determine relative gene expression.
5
Quantification of Smooth Muscle and Osteogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Tri-Reagent™ (Sigma-Aldrich) and quantified by spectrophotometry (ND-1000, Nanodrop Technologies, Wilmington, DE). Vascular smooth muscle alpha-actin (VSM-actin), smooth muscle protein 22 alpha (SM22α), myocardin (Myocd), smooth muscle-myosin heavy chain (Myhc), Runt-related transcription factor 2 (Runx2), osterix (Sp7 transcription factor), bone morphogenetic protein 2 (BMP2), Dickkopf (Dkk1), low density lipoprotein receptor-related protein 5 (Lrp5) and glycogen synthase kinase 3 beta (Gsk3β) mRNA levels were determined by quantitative real-time RT-PCR (Light cycler, Roche Diagnostics, Basel, Switzerland). cDNA was synthesized from 0.5 µg of total RNA with a first strand cDNA synthesis kit (Qiagen, Hilden, Germany) in the presence of random hexamers in a final volume of 20 µl followed by 42°C for 15 min and 95°C for 3 min. An RT-PCR SYBR Green kit (Qiagen) was used to quantify mRNA expression levels. The primers used for PCR are shown in Table 1 . mRNA expression was expressed as a value normalized to levels of 18S RNA.
6
Placental RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pool of six placental samples obtained from at least two litters from the same group was used total RNA extraction. RNA was extracted with Trizol (Invitrogen Life Technology) according to the manufacturer’s instructions and treated with DNase I to eliminate genomic DNA contamination. RT was accomplished using a commercially available first-strand cDNA synthesis kit (QIAGEN). The RT reactions were performed following the manufacturer’s protocol to reverse transcribe 1 μg of total RNA. Real-time PCR was performed with the Bio-Rad CFX96 real-time PCR instrument (Bio-Rad, Hercules, CA) and SYBR Green JumpStart Taq ReadyMix for Q-PCR according to the manufacturer’s protocol (Sigma-Aldrich). Gene expression was normalized using the housekeeping gene Gapdh as the reference gene. The primer sequences for the genes analyzed are listed in Table S1 , Table S2 and Table S3 . Primer sequences were obtained from Primer Bank or designed using Primer Express. Samples were analyzed using the ΔΔCt method.
7
Quantification of lncRNA RGMB-AS1 and RGMB mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the paired lung adenocarcinoma tissues and adjacent normal tissues and from cell lines following the manufacturer’s protocols for each kit. RNA quality was confirmed using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, USA). An OD260/280 of approximately 1.8 is the criterion of acceptable purity. Reverse transcription was achieved by following the manufacturer’s protocols of a First Strand cDNA Synthesis Kit (Qiagen, Germany). The relative levels of lncRNA RGMB-AS1 and RGMB mRNA were determined by quantitative real-time PCR, which was performed using the ABI Power SYBR®Green PCR Master Mix (Applied Biosystems, USA). The relative expression levels of lncRNA RGMB-AS1 and RGMB mRNA were calculated using the 2-ΔCt method and normalized to GAPDH.
8
Quantification of Osteogenic Markers in TRIP-1 Modulated MC3T3-E1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Control MC3T3-E1 cells, MC3T3-E1 overexpressing TRIP-1 and MC3T3 TRIP-1 shRNA cells were cultured to confluence. Total RNA was isolated using the Qiagen RNA isolation kit as per the manufacturer’s instructions. First strand synthesis was performed using First strand cDNA synthesis kit (Qiagen). The generated cDNA was subjected to gene specific quantitative PCR amplification. mRNA levels encoding for TRIP-1, RUNX2, ALP, OCN, GAPDH and HPRT were obtained using primers synthesized (Integrated DNA Technologies, Coralville, IA) from published sequences (Table 1 ). Fold change was calculated using –ΔΔCT method). Statistical significance between the control and TRIP-1 overexpressing cells were calculated using student’s t-test. All experiments were carried out in triplicates.
9
First-Strand cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 μg) was used for the synthesis of first strand cDNA using the First Strand cDNA Synthesis Kit (Qiagen Ltd. Crawley, UK) and oligo dT primers according to the manufactures instructions. The final volume of cDNA was adjusted to 120 μL with nuclease free water.
10
Quantification of Liver mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the liver tissue by the guanidinium thiocyanate method, and the quality of the samples was determined by the absorbance measurements at 260/280 nm. 2 μg total RNA was reverse-transcribed to cDNA, using the first strand cDNA synthesis kit (Qiagen) according to the manufacturer's instructions. The mRNA levels were measured under real-time PCR using TaqMan assay for both target and reference genes. Mouse TNF-alpha and MCP-1 primer/probe sets were designed according to the information of GenBank, as presented in Table 1 . GAPDH was used in separate tubes as reference control. Relative standard curves for all three templates were performed to compensate the efficiency of the PCRs. Quantification of TNF-alpha or MCP-1 mRNA levels was relative to the GAPDH mRNA levels. The real-time PCR reaction was performed on LightCycler 480 in a final volume of 25 μL. Each well of a 96-well plate was containing 2.5 μL 10 × PCR buffer, 1.5 μL MgCl2 (25 mM), 0.5 μL dNTPs (10 mM), 0.25 μL Taq DNA polymerase, 0.1 μL 100 μM each primer and probe, 2 μL cDNA, and ddH2O 17.95 μL. Thermal cycling conditions for TNF-alpha and MCP-1 included the following steps: denaturation at 95°C for 3 min, followed by 40 cycles at 98°C for 5 s and 60°C for 27 s (for GAPDH, 60°C for 15 s).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!