Total rna purification micro kit

We extracted RNA using a total RNA purification micro kit (Norgen cat.35300, Canada). We treated the lysate on the column with DNase I to remove DNA contamination. We extracted RNA from the three differentiation stages i.e., days 0, 26, and 39 in triplicates, and libraries were prepared by Illumine kits. The libraries were sequenced on Hi-Seq 2000 with 40 M reads per sample. We defined a TF degree of expression as follows: if the level of expression increases by at least 2-fold from Day 0 to Day 26, and the level of expression decreases/does not change from Day 26 to Day 39, then the TF is transcribed on day 26; otherwise, the TF was considered as not transcribed. This definition is used as a filter to eliminate TF binding to the REs of neuronal progenitors.

RNA isolation from sorted cells was performed using the Total RNA purification Micro Kit (Norgen Biotek) following the manufacturer's protocol with slight modifications: prior to isolation, 200 μl aliquots of the Buffer RL were desiccated at 60°C for 1 h using an Eppendorf Concentrator plus with the V-AQ mode and stored at room temperature. The exact volume of the sorted samples was evaluated. 1% of the sample volume β-Mercaptoethanol was added and the whole suspension was added to the desiccated RL Buffer. The salts were dissolved using a vortex mixer. Next, the volume was measured and 100% EtOH were added at a ratio of 1:1.75, mixed and the suspension was put on a spin column. The sample was centrifuged 1 min at 14.000×g and washed twice using 400 μl of wash solution A, discarding the flow through and centrifuged 1 min at 14.000×g. Finally, the column was spin-dried for 2 min, placed in a new tube and eluted using 20 μl RNase-free H₂O. Sample collection was done by centrifugation at 14.000×g. 1.5 μl were used for RNA quality analysis using an Agilent Bioanalyzer. All samples were analyzed prior to RNA sequencing by the DNA Microarray Facility of the MPI-CBG Dresden and stored at −80°C until sequencing was performed.

RNA was isolated from cell lines and EXOs using the “Total RNA Purification micro Kit” (NorgenBioteK Corp, Canada) according to the manufacturer’s protocol. In the first setting of experiment, to avoid any possible contamination of external RNAs, before exosome purification conditioned media were pre-treated with RNase (Roche, Nutley, NJ, USA) for 10 min at 37 °C. Real time quantification (qRT-PCR) of miR-222 (#000525), p27Kip1 (#Hs00153277_m1), FGF2 (#Hs00266645_m1), VEGFA (#Hs000900055_m1), ITGβ3 (#Hs00173978_m1) and Bcl-2 (#Hs00153350_m1) were performed according to the TaqMan technology (Applied Biosystems, Foster City, CA, USA). MiR-16 (#000391), RNU6B (#001093) and GAPDH (4326317E) were used as internal controls. The expression profile of Human Tumor metastasis genes was performed using the TaqMan Array 96-Well Plate (#4414229) (Applied Biosystems, Foster City, CA, USA).

Hippocampal neurons were infected as above. RNA was extracted at day 5 post infection using a total RNA purification Micro kit (NORGEN 35300). qPCR was performed for 8 proteostasis-related mRNAs: DNAJC2, DNAJC3, HSP90AB1, HSPA9, HSPA5, BAG4, DNAJB11 and PSMD1, and results were normalized to HPRT (see primers in Supplementary Table 2). This was performed in a total of N = 5–7 replicates. Subsequently, the average of each mRNA expression levels across all replicates was further mean-normalized across all samples for each gene separately, and presented in a CDF plot.

RNA from CTC samples was extracted with Total RNA Purification Micro Kit (Norgen Biotek, Thorold, ON, Canada) and eluted in 30 µL elution buffer. RNA from plasma was extracted with QIAamp circulating nucleic acid kit (QIAGEN, Hilden, Germany) and eluted in 65 µL elution buffer. Samples processed with this kit are referred to as ctRNA even for healthy controls that would only have normal cell free RNA. RNA from exosomes was extracted with Qiagen exoRNeasy serum/plasma Midi kit (QIAGEN, Hilden, Germany) and eluted in 30 µL. A total of 15 µL eluted RNA was reverse transcribed using SensiFAST cDNA synthesis kit (Bioline, Alexandria, Australia).

RNA purification was performed using the total RNA purification Micro kit (Norgen, 35300) according to manufacturer’s protocol. The concentration and quality of the RNA were measured by NanoDrop one (Thermo Fisher). The cDNA generation was done by using a High capacity cDNA reverse transcription kit (Applied Biosystem, 4368814) with RNase inhibitor (Applied Biosystem, N8080119) as described in the kit protocol. Then, the cDNA was diluted in ultra-pure water in a ratio of 1:5 (each biological replicate was assessed in triplicates). Reaction solutions were prepared for each set of primers including the genes E6AP/UBE3A and two different sets of primers for β-Actin. The reaction volume contained Fast SYBER green master mix (Applied Biosystem, 43856120), forward and reverse primers, ultra-pure water, and the cDNA template. To calculate relative RNA expression, the mean of two sets of primers for β-Actin was included as an endogenous control. The data were analyzed using the ΔΔCT method. The sequence of the primers used:

Gene name	Forward	Reverse
E6AP/UBE3A	AACTACAGAATATGACGGTGGC	TGTCTGTGCCCGTTGTAAAC
β-Actin set 1	ACCCAGCACAATGAAGATCAA	ACATCTGCTGGAAGGTGGAC
β-Actin set 2	GAGCACAGAGCCTCGCCTTT	ACATGCCGGAGCCGTTGTC