β nad

All CoA‐esters, β‐NAD⁺, NADH, α‐ketoglutarate dehydrogenase (porcine heart; αKGDH), α‐ketoglutaric acid, thiamine pyrophosphate (TPP), and EDTA were purchased from Merck. BSA was from Serva. Restriction enzymes were bought from NEB biolabs. IPTG was from Carl Roth. Ni‐NTA affinity resin was from Qiagen and 5 ml Strep‐Tactin® columns were purchased from IBA technologies. Purity of CoA‐esters was confirmed by HPLC‐UV analysis before usage.
Point mutations were introduced by PCR based cloning. Fragments for pAR159 and pAR160 were generated by amplification of pAR69 (Addgene, #122849) and pAR7016 with the primer pair: AR301 (5′‐gtgcccaatgatgccgtcag‐3′) and AR310 (5′‐ggcatcattgggcacGccttgggagaggttgcctgtgg‐3′; see Table S2). PCR products were treated with Dpn1 (NEB), purified by gel electrophoresis and DNA was extracted with the Wizard® SV Gel and PCR Clean‐Up System (Promega). Purified DNA was transformed into E. coli Stellar™ Competent Cells, 5 ml LB cultures were grown and plasmids were isolated with the PureYield™ Plasmid Miniprep System (Promega). Sequences of all plasmids were confirmed with the “dye terminator” method.

For Western blot analysis, the following antibodies were used: rat anti-PARP10 (sc-53858) from Santa Cruz Biotechnology (Santa Cruz, CA, USA); mouse anti-Aurora-A (15815719) from Thermo Fisher Scientific (Waltham, MA, USA); rabbit anti-phospho-T288 Aurora-A (#3079) and rabbit anti-MAR/PAR (#83372) from Cell Signalling Technology (Beverly, MA, USA); and mouse anti-GAPDH (ab8245) from AbCam (Cambridge, UK). Secondary antibodies were obtained from Merck (Darmstadt, Germany). For immunofluorescence analysis, the following antibodies were used: rabbit anti-Aurora-A (#14475) from Cell Signalling Technology (Beverly, MA, USA); mouse anti-Pericentrin (ab28144) from AbCam (Cambridge, UK); and rabbit anti-phospho-Ser10 Histone-H3 (06/570) form Merck (Darmstadt, Germany). Hoechst nuclear dye and RNAse were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Propidium Iodide (PI), Thymidine, PJ34, β-NAD⁺ and ATP were sourced from Merck (Darmstadt, Germany). OUL35 [47 (link)] was kindly provided by Prof. Lari Lehtio (University of Oulu, Finland) and Prof. Oriana Tabarrini (University of Perugia, Italy).

The following microbial strains were used: S. gordonii ATCC 10558, A. oris MG1, and P. gingivalis ATCC 33277. Strains were cultivated on trypticase soy agar [22 (link)] plates (Oxoid, Basingstoke, GB) with 5% of sheep blood for 24 h at 37 °C (A. oris MG1 and P. gingivalis ATCC 33277 in anaerobic conditions). Thereafter, microorganisms were suspended in 0.9% w/v NaCl solution (OD600 nm = 1). Then, suspensions of S. gordonii were mixed 1:1 either with A. oris or with P. gingivalis, before adding to the nutrient broth ((Wilkins-Chalgren broth (Oxoid) with 10 μg/ml β-NAD (Merck KGaA, Darmstadt, Germany)) brain heart infusion broth Oxoid). Extracted teeth had been incubated in the nutrient media with bacteria for 10 weeks. For half of the teeth, S. gordonii and A. oris were used for the other half S. gordonii and P. gingivalis. The boxes containing the teeth were opened in a laminar air flow cabinet and the roots were inoculated with one of the two bacterial suspensions. The boxes were incubated in an anaerobic chamber at 37 °C for 10 weeks. Every week, new bacteria were added and bacterial growth in nutrient media was checked. Exchange of the nutrient medium was performed every 3 days.

Nontypeable Haemophilus influenzae (NTHI) strain 86-028NP^{37 (link),38 (link)} was maintained frozen in LN₂ at passage #4 on artificial medium since its original isolation from the nasopharynx of a child who underwent tympanostomy tube insertion due to chronic otitis media. NTHI 86-028NP was grown in Brain Heart Infusion broth supplemented (sBHI) with hemin (2 µg/mL) (Sigma-Aldrich, Cat no. H9039) and β-NAD (2 µg/mL) (Sigma-Aldrich, Cat no. N1511) at 37 °C with 5% CO₂ in a humidified atmosphere. Methicillin-resistant Staphylococcus aureus (MRSA) (clinical isolate from child with cystic fibrosis) or Pseudomonas aeruginosa strain 142-1^{35 (link)} (University of North Texas) were grown on Tryptic Soy agar (TSA) or in Tryptic Soy broth. Escherichia coli strain UTI89^{22 (link)} was grown on Lysogeny Broth agar or in Lysogeny broth (LB) for 18–24 h at 37 °C, 5% CO₂ in a humidified atmosphere.

The assay used for the quantification of this enzyme was reproduced from Zou et al. [38 (link)]. LDH-detection assay mix was prepared with 543 μM nitro blue tetrazolium (N5514, Sigma), 814 μM β-NAD⁺ (N7004, Sigma), 20 U mL^-1 diaphorase (D2197, Sigma) and 50 mM lactic acid sodium salt (BIOLB0571, Astral Scientific) in 10 mM Tris-HCl buffer at pH 8.5. A volume of 50 μL of sample was added to wells of a 96-well microplate, 50 μL of LDH-detection assay mix was also added and incubated for 30 min at room temperature. To stop the reaction, 10 μL of 1 M HCl was added and absorbance measured at 560 nm.
Results of LDH were expressed as percentage of total cellular content (% TCC). Gill cells at the same concentration used for the exposure assays were exposed to GSe medium, detached and ruptured by sonication. Samples were centrifuged at 370 ×g for 5 min. The supernatant was recovered and stored at -20°C until analysis. This treatment represented 100% LDH or Total cellular content.

A gel-based PAR-turnover assay was performed to evaluate the enzymatic activity of ARH3^WT, ARH3^D77A, ARH3^D78A, ARH3^D314A, and ARH3^D316A, as described previously (14 (link), 40 (link)). Briefly, 2 μM of the catalytic domain of human PARP1 (PARP1C; residues 375–1014) was auto-PARylated at 37 °C for 30 min in the presence of 2 μM DBD of PARP1 (residues 1–374), 2 μM double-stranded DNA, and 400 μM β-NAD⁺ (Sigma) in a buffer containing 100 mM NaCl, 50 mM Tris (pH 7.5), 10 mM MgCl₂, and 2 mM DTT. ARH3 proteins (in the presence of 5 mM EDTA, Mg²⁺, or Ca²⁺) with final concentrations of 2 μM were mixed with the PARylated PARP1C substrate, followed by incubation for 1 h in 37 °C. Reactions then were stopped by adding 4× SDS-loading dye (Bio-Rad) and visualized by Coomassie blue staining of SDS-polyacrylamide gels.