Cm2b4

Cells were lysed in 0.6% SDS, 1 mM Ethylenediaminetetraacetic acid (EDTA), 10 mM Tris- HCl (pH 8.0), 2 mM NaF, 2 mM NaVO3 supplemented with a protease inhibitor cocktail (Roche Diagnostics, Basel, Switzerland). Samples were resolved by SDS-PAGE, transferred to nitrocellulose membrane, blocked for 1 h with Phosphate buffered saline (PBS) containing 0.05% Tween 20 and 5% powdered skim milk, then incubated overnight with anti-HA (ab18181, Abcam, 1:1000), LT (CM2B4, Santa Cruz, 1:200), sT (2T2, Hybridoma obtained from C. Buck laboratory), anti-GLI1 (C68H3, Ozyme, 1:200), anti-SOX2 (EPR3131, Abcam, 1:200), anti-ATOH1 (polyclonal, Proteintech, 1:600), or anti-Actin antibody (A5441, Sigma, 1:1000), washed three times with PBS with 0.05% Tween 20 (PBS/Tween), then incubated for 1 h with a peroxidase-conjugated secondary antibody. Finally, following three washes with PBS/Tween, respective proteins were detected by using a chemiluminescence detection procedure. All primary Western blot membranes’ acquisition without cropping and intensity adjustment are available in Figure S8.

LT protein turnover was measured by a cycloheximide (CHX) chase assay using quantitative immunoblot analysis. LT plasmids were co-transfected with an eGFP plasmid to normalize transfection efficiency, and all experiments were performed in triplicate. Cells were lysed in IP buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% TritonX-100, 1 mM PMSF, 1 mM benzamidine) and whole cell lysates without pre-clearing were used for direct immunoblotting. Primary antibodies were incubated overnight at 4 °C, followed by 1 h of secondary antibody incubation at room temperature. All signals were detected using quantitative infrared (IR) secondary antibodies (IRDye 800CW goat anti-mouse, 800CW goat anti-rabbit, 680LT goat anti-rabbit IgG, 680LT goat anti-mouse IgG) (LI-COR); signal intensities were analyzed using a laser-scanning imaging system, Odyssey CLX (LI-COR). CM2B4 (Santa Cruz Biotechnology, Dallas, TX, USA), 2T2 (Millipore, Billerica, MA, USA), PAb416 (Santa Cruz Biotechnology), c-Myc (9E10, Santa Cruz Biotechnology), GFP (D5.1, Cell Signaling) HA-Tag (C29F4, Cell Signaling, Danvers, MA, USA), anti-FLAG (M2, Sigma-Aldrich, St. Louis, MO, USA), anti-α-Tubulin (12G10, DSHB), β-Actin (13E5, Cell Signaling) antibodies were used for this study.

Cells were lysed using the ELB lysis buffer containing 150 mM NaCl, 50 mM Hepes pH 7.5, 5 mM EDTA, 0.1% NP-40, 20 mM β-glycerophosphate, 0.5 mM sodium orthovanadate and a protease inhibitor (Roche). The immunoblotting procedure was performed as described [38 (link)]. The antibodies used in this study were directed against MCPyV-LT (CM2B4; Santa Cruz Biotechnologies), β-tubulin (TUB 2.1; Sigma-Aldrich, Ottobrunn, Germany) and vinculin (hVIN-1; Sigma-Aldrich). Uncropped blots are given in Supplementary Figures S9 and S10)

The luciferase reporter plasmids with the consensus NCCR MCPyV in early (pGL3-cons-E) or late (pGL3-cons-L) orientation have been previously described [24 (link)]. The luciferase reporter plasmids containing the NCCR of the variants 10b, 15a, 16b, HUN, MKL-1, MS-1 were generated by GenScript (Piscataway, NJ, USA). Each NCCR was cloned in both early (NCCR-E) and late (NCCR-L) orientation, respectively. The luciferase plasmids with the NCCR containing the 25 bp duplication described by Hasida et al. [34 (link)] was generated by site-directed mutagenesis using the plasmid pGL3-cons-E (pGL3-cons-L, respectively) containing the consensus NCCR and the complementary primers 5′- GGCCGGAGGCTTTTTTTTCTCTTACAAAGGGAGGAGGACATTTCTCTTACAAAGGG-3′ and 5′-CCCTTTGTAAGAGAAATGTCCTCCTCCCTTTGTAAGAGAAAAAAAAGCCTCCGGCC-3′. The empty expression vector pcDNA3.1(+) was purchased from Invitrogen (ThermoFisher Scientific, Oslo, Norway). The MCPyV expression vectors for full-length and truncated LT have been previously described [35 ], and all plasmids were verified by sequencing. Expression of full-length and truncated LT was confirmed by western blotting using antibody CM2B4 from Santa Cruz Biotechnology (Dallas, TX, USA; cat. no. sc-136,172; results not shown).