Unmodified, desalted, and HPLC purified pre-miR-21 was purchased
from Eurofins Scientific (Louisville, KY, USA). RNA was folded via
resuspending with buffer (10 mM Tris-HCl pH 7.5 with 20 mM NaCl), and heated
to 95°C for 90 sec, and allowed to cool to room temperature
overnight. Folded RNA was aliquoted and stored in −20°C until
assayed. The following sequence of pre-miR-21 was purchased:
5’-UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCU
GUCUGACA-3’
Butylcycloheptyl prodiginine (bPGN) was supplied by Developmental
Therapeutics Program (DTP), Division of Cancer Treatment and Diagnosis in
the National Cancer Institute (NCI). Plates for high-throughput screens were
provided by NCI, Molecular Targets Program (MTP). Compounds such as 5-FU,
obatoclax, prodigiosin, navitoclax, spermidine, methoctramine,
hexachlotophene, and regorafenib were purchased from Sigma Aldrich or
selleckchem.com .
from Eurofins Scientific (Louisville, KY, USA). RNA was folded via
resuspending with buffer (10 mM Tris-HCl pH 7.5 with 20 mM NaCl), and heated
to 95°C for 90 sec, and allowed to cool to room temperature
overnight. Folded RNA was aliquoted and stored in −20°C until
assayed. The following sequence of pre-miR-21 was purchased:
5’-UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCU
GUCUGACA-3’
Butylcycloheptyl prodiginine (bPGN) was supplied by Developmental
Therapeutics Program (DTP), Division of Cancer Treatment and Diagnosis in
the National Cancer Institute (NCI). Plates for high-throughput screens were
provided by NCI, Molecular Targets Program (MTP). Compounds such as 5-FU,
obatoclax, prodigiosin, navitoclax, spermidine, methoctramine,
hexachlotophene, and regorafenib were purchased from Sigma Aldrich or