Viral RNA quantification was performed using real-time qPCR targeting the SARS-CoV-2 subgenomic RNA transcript for the envelope (E) gene, as previously reported (Wölfel et al., 2020 (link)). Briefly, RNA was isolated from the tissue homogenates using Viral RNA Extraction Kit (Takara Bio, 9,766). Real-time qPCR was performed using the One Step PrimeScript III RT-PCR Kit (Takara Bio, RR600A) with the primer pairs E-Leader, E-reverse, and E-probe (Table 1 ). The cycling conditions were one cycle at 52°C for 5 min, then 95°C for 10 s, followed by 45 cycles at 95°C for 10 s and 60°C for 30 s. pUC19-2019-nCoV-E plasmid was synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) as an E gene DNA standard and the inserted base sequence reported in a previous study was used (Wölfel et al., 2020 (link)). An E gene DNA sample was also run at the same time for conversion of cycle threshold value to genomic copies using the standard curve-based method.
One step primescript 3 rt pcr kit
Manufactured by Takara Bio
The One Step PrimeScript III RT-PCR Kit is a reagent designed for reverse transcription and polymerase chain reaction (RT-PCR) in a single-step process. It contains PrimeScript III Reverse Transcriptase and a high-performance DNA polymerase for efficient RNA-to-cDNA conversion and subsequent PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Viral rna extraction kit, by Takara Bio (1 mentions)
Applied biosystems 7500 fast real time pcr instrument, by Thermo Fisher Scientific (1 mentions)
Rox dye 2, by Takara Bio (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Nr 52287, by BEI Resources (1 mentions)
7 protocols using one step primescript 3 rt pcr kit
1
SARS-CoV-2 Viral RNA Quantification
2
SARS-CoV-2 Detection: N1 and N2 Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time RT-PCR analysis of SARS-CoV-2, the N1 assay was used for method development and both N1 and N2 assays (Lu et al., 2020 (link)) were used for the final RV-RT-PCR method evaluation with spiked swabs. The primers and probes were supplied by Biosearch Technologies (Novato, CA; Cat. No. KIT-NCOV-PP1−1000). Ten-fold dilutions of a synthetic RNA standard (BEI Resources; Cat. No. NR-52358), resulting in levels ranging from 1.5 to 1.5 × 105 viral genome copies per RT-PCR reaction, were run with each PCR plate along with a negative control (nuclease-free water only).
Each 25-μL RT-PCR reaction contained 12.5-μL 2X Master Mix and 0.5-μL ROX Dye II (One Step PrimeScript™ III RT-PCR Kit; Takara Bio, Mountain View, CA; Cat. No. RR600B), 0.625-μL primers/probe (5 μM probe, 20 μM each forward and reverse primers), 6.375-μL PCR-grade water, and 5-μL RNA extract. An Applied Biosystems 7500 Fast Real-Time PCR Instrument (Thermo Fisher Scientific) was used with the following thermocycling conditions: 50°C for 15 min; 95°C for 2 min; 45 cycles of 95°C for 3 s and 55°C for 30 s.
Each 25-μL RT-PCR reaction contained 12.5-μL 2X Master Mix and 0.5-μL ROX Dye II (One Step PrimeScript™ III RT-PCR Kit; Takara Bio, Mountain View, CA; Cat. No. RR600B), 0.625-μL primers/probe (5 μM probe, 20 μM each forward and reverse primers), 6.375-μL PCR-grade water, and 5-μL RNA extract. An Applied Biosystems 7500 Fast Real-Time PCR Instrument (Thermo Fisher Scientific) was used with the following thermocycling conditions: 50°C for 15 min; 95°C for 2 min; 45 cycles of 95°C for 3 s and 55°C for 30 s.
3
SARS-CoV-2 Viral RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated from 70 μL of serum using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol and quantified using the One-Step Prime Script III RT-PCR Kit (TaKaRa) and the universal primers for N2 region of SARS-CoV-2: NIID_2019-nCOV_N_F2 AAATTTTGGGGACCAGGAAC and NIID_2019-nCOV_N_R2 TGGCAGCTGTGTAGGTCAAC with NIID_2019-nCOV_N_P2 probe: FAM-ATGTCGCGCATTGGCATGGA-TAMRA. Five microliter of the extracted RNA was used for the reaction. The PCR conditions were 25°C for 10 min for activation, 52°C for 5 min for reverse transcription, and 95°C 10 s for inactivation, followed by 45 cycles of 95°C for 5 s and 20°C for 30 s. The fluorescent signals were detected with the QuantStudio 3 Real-Time PCR System (Applied Biosystems). The amount of viral RNA in serum was successively measured in patients treated with tocilizumab (n = 11), dexamethasone (n = 15), or dexamethasone followed by tocilizumab (n = 12).
4
Quantification of Viral RNA Copies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of viral RNA copies, total RNA was extracted from cells using a PureLink RNA Mini Kit (Thermo Fisher Scientific), and then first-strand cDNA synthesis and qRT-PCR were performed using One Step PrimeScript III RT-PCR Kit (Takara Bio) and QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific), respectively, according to the manufacturer’s protocols. For quantification of viral RNA, primer sets detecting the region encoding part of the viral nucleocapsid phosphoprotein as reported in a previous study22 (link) were used (See Table S1 for primer information). Fluorescent signals were determined by QuantStudio 5 Real-Time PCR System.
5
SARS-CoV-2 RNA Quantification in Mouse Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the expression levels of intracellular genes and SARS-CoV-2 viral genes, total RNA was extracted from mouse lung samples using the RNeasy Mini Kit (Qiagen, Hilden, Germany). The SARS-CoV-2 RNA copy numbers were determined by real-time qRT-PCR using the One Step PrimeScript III RT-PCR Kit (Takara). The following primer sets were used for RT-PCR: SARS-CoV-2_N2 forward, 5′-TTACAAACATTG GCCGCAAA; SARS-CoV-2_N2 reverse 5′-GCGCGACATTCCGAAGAA; SARS-CoV-2_N2 probe 5′-FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1; β-actin forward, 5′-GATTACTGCTCTGGCTCCTAG; β-actin reverse, 5′-GACTCATCGTACTCCTGCTTG, β-actin probe; 5′-/56-FAM/CTGGCCTCA/ZEN/CTGTCCACCTTCC/3IABkFQ Real-time qPCR was conducted using the QuantStudio3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA).
6
Determining SARS-CoV-2 Detection Limits in Wastewater
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The limits of detection at 95% and 50% confidence intervals (LoD95% and LoD50%, respectively) were obtained by detecting gamma-irradiated SARS-CoV-2 (Bei Resources, NR-52287) ten-fold serially diluted from 1.7 × 103 to 1.7 ge/mL and seeded in 200 mL of wastewater samples tested negative for SARS-CoV-2. Samples were also spiked with PEDV (107 gc/mL) as process control. Viral particles were concentrated by the aluminum-based adsorption-precipitation method and RNA extracted using both RNA extraction protocols as described above. Experiments were performed in triplicate by concentrating three independent samples for each inoculation level. LoD95% and LoD50% were calculated according to Wilrich and Wilrich (2009) (link).
To determine SARS-CoV-2 detection limits, five different targets were used: N1 and N2 regions of the nucleocapsid gene, the envelope gene (E), and regions IP2 and IP4 of the RNA-dependent RNA polymerase gene (RdRp). The amplification of the N1 region was conducted as previously described. Region N2 detection was fulfilled using primers and probes available at the diagnostic panel assays 2019-nCoV RUO Kit from the US CDC (CDC, 2020 ). Detection of gene E was performed using primers and probes described by Corman et al. (2020) (link) (Table S1 and S2). To amplify and quantify IP2 target, One Step PrimeScript™ III RT-PCR kit (Takara Bio) was used.
To determine SARS-CoV-2 detection limits, five different targets were used: N1 and N2 regions of the nucleocapsid gene, the envelope gene (E), and regions IP2 and IP4 of the RNA-dependent RNA polymerase gene (RdRp). The amplification of the N1 region was conducted as previously described. Region N2 detection was fulfilled using primers and probes available at the diagnostic panel assays 2019-nCoV RUO Kit from the US CDC (CDC, 2020 ). Detection of gene E was performed using primers and probes described by Corman et al. (2020) (link) (Table S1 and S2). To amplify and quantify IP2 target, One Step PrimeScript™ III RT-PCR kit (Takara Bio) was used.
7
SARS-CoV-2 RT-qPCR Calibration Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR calibration was performed in two institutions. Source B performed the test using two types of reference material: synthetic SARS-CoV-2 RNA or plasmid bearing viral genes as described by Jacot et al. [20 ]. The SOPHiA GENETICS lab performed the test using synthetic SARS-CoV-2 RNA, CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A) according to the manufacturer's instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!