Cells of the wild type strain XL280 and the indicated strains were cultured in YPD liquid medium at 30°C for 16 hr. Three biologically replicates were used. Total RNA samples were extracted using the PureLink® RNA Mini Kit (Life Technology) and their integrity was confirmed with RNA gel electrophoresis. Each RNA sample (8 μg) was treated with DNase (TURBO DNA-free™) according to the manufacture’s instruction. DNase-treated RNA samples were used as templates in the synthesis of the first strand cDNA using GoScript™ Reverse Transcription System (Promega) per the instruction from the manufacture. The resulting cDNA products were diluted to 8 ng/μl and 2 μl was used as template for quantitative real-time PCR (qRT-PCR). qRT-PCR was performed using the SYBR FAST qPCR master mix (KAPA Biosystems, Wilmington, MA) on a realplex2 instrument (Eppendorf). The house-keeping gene TEF1 was used as the internal control for each sample to normalize the gene transcript level as we described previously (Chacko et al., 2015 (link)). The relative levels of transcripts were quantified using the ΔΔCt method as we described previously (Wang et al., 2014 (link); Wang et al., 2012 (link)). We used One-Way ANOVA for multiple comparison and P values ≤ .05 were considered statistically significant. Primers for qRT-PCR are included in the Supplemental Table 2 .
Realplex2 instrument
Manufactured by Eppendorf
The Realplex2 instrument is a real-time PCR (Polymerase Chain Reaction) system designed for accurate and reliable nucleic acid quantification. It features precise temperature control, multiple detection channels, and advanced data analysis capabilities to support a wide range of real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol ls, by Thermo Fisher Scientific (3 mentions)
Ncode mirna first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Faststart universal sybr green master mix, by Roche (3 mentions)
Magmax 96 total rna isolation kit, by Thermo Fisher Scientific (2 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix reagent, by Qiagen (2 mentions)
Neutravidin, by Thermo Fisher Scientific (2 mentions)
Dynabead positive selection, by Thermo Fisher Scientific (2 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Sybr fast qpcr master mix, by Roche (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Easysep mouse cd4 t cell isolation kit, by STEMCELL (1 mentions)
Superscript 3 first strand synthesis for rt pcr, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 4 vilo master mix, by Thermo Fisher Scientific (1 mentions)
Rna stat 60, by Tel-Test (1 mentions)
7 protocols using realplex2 instrument
1
Quantitative Real-Time PCR Analysis
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, 4–6 wells of organoids were pooled, pelleted, and dissolved in Trizol reagent prior to processing by the MagMAX 96 Total RNA Isolation Kit (Ambion, Life Technologies). 300–500ng of RNA was used for cDNA synthesis using the Superscript First Strand Synthesis System (Invitrogen). Quantitative real-time PCR was carried out using SYBR green master mix reagent (QIAGEN) in the Realplex2 instrument (Eppendorf). cDNA samples were diluted 1:5 to 1:10 for all analyses, which were performed in triplicate. Expression values were obtained using the ΔΔCT method and normalized to GAPDH expression; average values are shown as the mean ± standard deviation (SD). Primer sequences are provided in Supplementary Table 3 .
3
Murine CD4+ T Cell Activation and miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD4+ T cells from the spleen and lymph nodes of mice were enriched by Dynabead-positive selection (Invitrogen, L3T4. Cells were stimulated with biotinylated anti-CD3 (clone 2C11, 1μg/ml) and anti-CD28 (clone 37.51, 0.5μg/ml) for 3 days on plates pre-coated with NeutrAvidin (5μg/ml, Thermo Fischer Scientific), then rested with 20 units/mL recombinant IL-2 (National Cancer Institute) for an additional 2 days. Cells were cultured in DMEM high glucose media supplemented with 10% FCS, pyruvate, nonessential amino acids, MEM vitamins, L-arginine, L-asparagine, L-glutamine, folic acid, beta mercaptoethanol, penicillin, and streptomycin. For miRNA qPCR analysis, cells were lysed in Trizol LS (Life Technologies), total RNA isolated, and RNA quantified on an ND1000 Spectrophotometer (NanoDrop). Reverse transcription of miRNA was performed with the NCode miRNA First-Strand cDNA Synthesis Kit (Life Technologies). Forward primers were the mature miRNA sequences (miRbase.org ) and a universal reverse primer was used from the kit. Expression values were normalized to the 5.8S ribosomal RNA (F: ATCGTAGGCACCGCTACGCCTGTCTG). qPCR was performed in technical duplicates using FastStart Universal SYBR Green Master mix (Roche) on a Realplex2 instrument (Eppendorf).
4
Murine CD4+ T Cell Activation and miRNA Analysis
5
Quantitative Analysis of miRNA and mRNA
6
Quantification of Parasite Transcript Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify transcript levels of PAD1, parasites were grown to a density of 190,000 cells/mL for low-density samples or ≥1 million cells/mL for high-density samples. RNA was extracted from low- or high-density parasite populations using RNA Stat-60 (Tel-Test) following the manufacturer’s protocol and quantified on a NanoDrop 2000c. A 2.5-μg amount of RNA was used to generate cDNA using SuperScript IV VILO master mix (Fisher Scientific; 11756050) according to the manufacturer’s protocol. cDNA was amplified using 2× SYBR green master mix (Life Technologies 4309155) and primers and quantified on an Eppendorf Realplex2 instrument. For PAD1, the primers used were GACCAAAGGAACCTTCTTCCT and CACTGGCTCCCCTAAGCT , and for URA3, the primers used were CGGCAGCAGTTCTCGAGT and TGGCGTGTACCTTGAGGC . For differentiation experiments, the primers used for EP1 were TCTGCTCGCTATTCTTCTGTTC and CCTTTGCCTCCCTTAGTAAGAC , and for Tb927.10.9400 SF1, the primers used were GGTATGGTTCATCAGGAGTTGG and CGTTAGCACTGGTATCCTTCAG .
7
RNA Extraction and qRT-PCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!