XNA reverse transcription was primed using DNA or mixed DNA-2’-O-methyl-RNA primers (Supplementary file 3 ). ANA was reverse transcribed using RTI521L as described previously (Pinheiro et al., 2012 (link); Taylor and Holliger, 2015 (link)). HNA and AltNA were reverse transcribed using a novel polymerase, polTK2, which will be described elsewhere. XNA RT reactions were isolated using streptavidin beads as described previously (Taylor and Holliger, 2015 (link)), prior to amplification using OneTaq hot-start master mix (NEB), or a blend of OneTaq and ThermoScript (Thermo Fisher), with appropriate primers (Supplementary file 3 ).
Onetaq hot start master mix
Manufactured by New England Biolabs
Sourced in United States
OneTaq Hot Start master mix is a pre-mixed, ready-to-use solution that contains Taq DNA polymerase, buffer, and dNTPs. The hot-start feature enables the polymerase to remain inactive at lower temperatures, preventing non-specific amplification.
Automatically generated - may contain errors
Lab products found in correlation
Phix control, by Illumina (2 mentions)
Miseq reagent kit and instrument, by Illumina (2 mentions)
Nextflex series, by Illumina (2 mentions)
Miseq method, by Illumina (2 mentions)
Pcr purification kit, by Qiagen (2 mentions)
Thermoscript, by Thermo Fisher Scientific (1 mentions)
Generuler 1 kb dna ladder, by Thermo Fisher Scientific (1 mentions)
Mastercycler nexus thermal cycler, by Eppendorf (1 mentions)
Polyu polymerase, by New England Biolabs (1 mentions)
7 protocols using onetaq hot start master mix
1
Reverse Transcription of Diverse Nucleic Acids
2
Identifying Spontaneous Mutants in P. aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A spontaneous mutant of P. aeruginosa JB2 deficient in growth on 2-CBa was acquired by culturing on 1% glycerol as described previously (Hickey and Focht, 1990 (link)). Genomic DNA was extracted from the mutant by using an Illustra Bacterial Genomic DNA kit (GE Healthcare). PCR primers were designed to target regions in ICEclc-JB2 that were diagnostic of structure in the variable and core key regions (Table 1 ). All oligonucleotides used as primers were confirmed by BLAST against the P. aeruginosa JB2 genome as specific for the targeted location. PCR was done with ca. 50 ng of gDNA template in OneTaq Hot Start Master Mix containing Standard Reaction Buffer (New England Biolabs) according to the manufacturer’s recommendation. The thermal cycling program was an initial denaturation (94°C, 30 s) followed by 30 cycles of: 94°C (15 s), 55°C or 62°C (15 s) and 68°C (60 s). The final extension was 68°C for 5 min. The annealing temperature used in Step 2 of the 30 cycle program was either 55°C or 62°C depending on the primer set (Table 1 ). All PCR assays were run in an Eppendorf Mastercycler Nexus Thermal Cycler. Analysis of PCR products was done by electrophoresis in agarose gels (1% in TAE buffer) at 100 V for 3 h. The size of PCR products was assessed by comparison to a GeneRuler 1 kb DNA ladder (ThermoFisher).
3
PolyU Tailing for Random Pool RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For selected reactions with fully random pools, polyU tails were added to provide a primer-binding site prior to RT-PCR. PolyU tailing was performed using 0.2 U/µl polyU polymerase (NEB) in 1X NEB Buffer 2, 0.5 mM UTP for 20 min at 37 °C, followed by heat inactivation for 1 min at 75 °C. Next, RT-PCR was performed (with or without prior polyU-tailing) using the SMARTer RT-PCR system (Clontech), according to the manufacturer’s protocol, using the supplied SMARTer oligo as forward primer, and an oligo containing either a polyA- or polyT as reverse primer (Supplementary file 3 ; Figure 5—figure supplement 1 ). cDNA was amplified using OneTaq hot-start master mix (NEB) supplemented with appropriate primers (Supplementary file 3 ).
4
Illumina-based deep sequencing of XNA selections
5
One-Step and Two-Step RT-PCR Protocols for ISS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the combined one-step RT-PCR, 100 ng of RNA from each condition was added to a tube and combined with OneTaq One-Step RT-PCR mix (NEB, E5315S) and 0.4 μM of each primer (S1 Table ). The reactions were frozen at -80°C and maintained in a frozen state until operations on board the ISS. The RT-PCR protocol was as follows: 48°C/20 min, [94°C/20 sec, 56°C/30 sec, 68°C/60 sec] x24/28, 68°C/10 sec. The two-step semi-quantitative PCR combined 1 μL of cDNA as the template, OneTaq Hot Start master mix (NEB, M0484S) and 0.4 μM of each primer. The samples were frozen at -80°C and remained frozen until operations on board the ISS. The PCR protocol was identical for the one-step and two-step protocols. Upon returning to earth, the samples were run on a 2% agarose gel for analysis.
6
Illumina-based deep sequencing of XNA selections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplified polyclonal cDNA from XNA selections was prepared for deep sequencing by the Illumina Miseq method by appending the bridge-amplification sequences by PCR. Sequencing library generating PCR reactions were performed with OneTaq Hot Start master mix (NEB, USA) with 10 ng/50ul gel-purified polyclonal template DNA (see above), 0.1 μM primers (P5_P2 and P3_Test7-2) and cycling conditions 94°C for 1 min, 10×[94°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec], 72°C for 2 min. Sequencing library DNA was purified using a PCR purification kit (Qiagen, Netherlands), then a 12pM sample of pooled libraries plus 20% PhiX control (Illumina, UK) was denatured and sequenced (single-end read, 75 cycles) using a MiSeq reagent kit and instrument (Illumina, UK) according to manufacturer’s instructions. Libraries were barcoded using variants of the P5_P2 primer containing 6nt sequences from the NEXTflex series (Illumina, UK). Data was analysed using the Galaxy server33 (link)-35 (link) and sequences ordered by abundance.
7
Rapid Malaria Detection via LAMP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ethical approval was obtained to test blood samples obtained from malaria patients who were undergoing a trial on artemisinin-based combination therapy (“The Effects of Artemisinin-Based Combination Therapy (Act) on The Dynamics of Plasmodium falciparum, P. Malariae and P. ovale Infections in Ghana” (GHS-ERC:005/12/17)). Patient consent was obtained and the samples were anonymised providing only the regional testing location and the outcome of a PCR test performed in 20µL reaction volumes to process the clinical samples. These results provided a ‘gold standard’ reference for the LAMP comparison on the same samples. The LAMP assay followed the protocol above. Initial testing received approval from the Human Biology Research Ethics Committee (HBREC) Cambridge, approval HBREC.2019.10: (“Specific, Sensitive and Rapid Detection of Plasmodium Infection in Malaria Patients and mosquitoes by Loop-mediated Isothermal Amplification (LAMP) and Recombinase Polymerase Amplification (RPA) assays”). The PCR reaction contained 1 × OneTaq® hot start master mix (New England BioLabs Inc.), 0.25 µM of forward (5’- TTAAACTGGTTTGGGAAAACCAAATATATT) and reverse (5’-CCTGTTGTTGCCTTAAACTTC) primers [20 (link)] and 1µL of clinical DNA. The temperature conditions for the 50 cycle PCR are listed in Table S7.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!