The largest database of trusted experimental protocols

Abi 3730xl pop7 dna sequencing analysis 5

Manufactured by Thermo Fisher Scientific
Sourced in United States

The ABI 3730XL POP7 DNA sequencing analysis 5.2 is a laboratory instrument designed for DNA sequencing analysis. It features a capillary electrophoresis system and utilizes the POP7 polymer for DNA separation and detection.

Automatically generated - may contain errors

2 protocols using abi 3730xl pop7 dna sequencing analysis 5

1

Sequencing of Human BMPR-IA Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated from peripheral blood of participants using the Wizard Genomic DNA Purification Kit(Promega, Madison, WI, USA). The complete coding sequence of human BMPR-IA gene (GenBank Accession No: NM004329.2) was amplified by polymerase chain reaction (PCR) using a standard protocol [23 (link)]. The DNA fragments containing the exon sequences of BMPR-IA gene was then respectively amplified using ten pairs of specific primers (Table 1). The PCR products were analyzed by direct sequencing using BigDye Terminator cycle sequencing on an ABI 3730XL POP7 DNA sequencing analysis 5.2 (Applied Biosystems, Carlsbad, CA, USA).

Ten pairs of primers were used to amplify the complete exon sequences of human BMPR-IA gene by PCR using a standard protocol

PrimerForwardReverseAnnealing temperature (°C)
Primer1GCGTTGGATGGGAGCGATAAGGAAGCTGCGCACAGTGTTG58
Primer2CTCACGTCGGTCCTGTCCCCCTGCTCCATGCCTCAC61
Primer3CGGAGGAGTTTATCACCTCAGCAGAGCTTCCATCATGGCCAAAAGTTACTAGCA60
Primer4AGAGATTGGAATCCGCCTGCCGGGCTTACCCGCGAGTGGGAGACAAAAGAGG55
Primer5GGACTATTGAGATTGTTTAATATACGAAAGAACAGAAGCAAGAAATAGTG55
Primer6GGACTATTGAGATTGTTTAATATACGAAAGAACAGAAGCAAGAAATAGTG55
Primer7CCACAATGCATCTGGCCCCAAGGAGTGTGATTATTACACATGGCATGCCTGTATC55
Primer8ACATCAGATTACTGGGAGCCTATAGCAAAGCAGCTGGAG52
Primer9AAGCCTTAAGAAGATAAATGAATTACCCTAATGAAGTTTTTG62
Primer10TGATTAGTGTCTCCAGTCAAGCTCTCAGGTAAAAGGCAAAGTC50
+ Open protocol
+ Expand
2

Genomic DNA Isolation and BMP2 Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated using Wizard Genomic DNA Purification Kits (Promega, USA) from each individual included in the study. The entire BMP2 coding sequence was amplified in overlapping fragments of 300–600 base pairs by polymerase chain reaction (PCR). In terms of the BMP2 gene, several SNPs were already reported [21] (link), [22] (link). We analyzed rs2273073 (T/G) and rs235768 (A/T) among 11 SNPs within BMP2 gene that have been previously described. Primers were designed in close proximity to the selected SNPs which are summarized in Table 1 and Table 2; the sequences of the BMP2 gene were obtained from http://www.ncbi.nim.nih.gov. The PCR products including the SNPs were genotyped by direct sequencing using BigDye Terminator cycle sequencing on an ABI 3730XL POP7 DNA sequencing analysis 5.2 (Applied Biosystems, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!