Cell pellets were lysed using NP-40 lysis buffer (150 mM NaCl, 50 mM Tris at pH 8.0, 1%NP-40 supplemented with phosphatase inhibitor cocktails 2 and 3 [Sigma] and protease inhibitor mix [Sigma]). Pellets were vigorously vortexed and incubated for 30 min at 4°C while rotating. Lysates were then quantified using the BCA kit (Thermo Scientific) according to the manufacturer's protocol. Protein sample buffer (3% SDS, 5% β-mercaptoethanol, 10% glycerol, 62 mM Tris at pH 8.0) was added, and samples were loaded on SDS–polyacrylamide gels for electrophoresis. Proteins were transferred to nitrocellulose membranes, blocked with 3% milk in TBST (0.05% Tween-20 in TBS), and incubated with primary antibodies as follows: anti-GAPDH (Millipore), anti-p53 (Biosystems), anti-Dnmt1 (Abnova), anti-Dnmt3a (Abcam), anti Dnmt3b (Abcam), anti TET2 (Abcam), and anti TET1 (GeneTex). Membranes were washed with TBST and incubated with horseradish peroxidase (HRP)-conjugated anti-IgG antibodies. Proteins were visualized using the Enhanced Chemo-Luminescence (ECL) detection kit (Amersham).
Anti tet2
Manufactured by Abcam
Sourced in United States
Anti-TET2 is a primary antibody that binds to the TET2 (ten-eleven translocation 2) protein. TET2 is a dioxygenase enzyme that plays a role in the demethylation of DNA. This antibody can be used to detect and study the TET2 protein in various applications, such as Western blotting, immunohistochemistry, and immunocytochemistry.
Automatically generated - may contain errors
Lab products found in correlation
Anti dnmt3a, by Abcam (2 mentions)
Anti dnmt3b, by Abcam (2 mentions)
Anti tet3, by Abcam (2 mentions)
Anti stat3, by Cell Signaling Technology (2 mentions)
Anti β actin, by Merck Group (2 mentions)
G dynabeads, by Thermo Fisher Scientific (2 mentions)
Anti histone h3, by Abcam (2 mentions)
Anti pspc1, by Santa Cruz Biotechnology (2 mentions)
Anti gapdh, by Protein Technologies (2 mentions)
Anti flag tag, by Merck Group (2 mentions)
Anti oct4, by Santa Cruz Biotechnology (2 mentions)
Phosphatase inhibitor cocktails 2 and 3, by Merck Group (1 mentions)
Bca kit, by Thermo Fisher Scientific (1 mentions)
Anti gapdh, by Merck Group (1 mentions)
Protease inhibitor mix, by Merck Group (1 mentions)
Anti dnmt1, by Abnova (1 mentions)
Anti tet1, by GeneTex (1 mentions)
Anti dnmt1, by Abcam (1 mentions)
Anti ki67, by Abcam (1 mentions)
Anti tet1, by Abcam (1 mentions)
13 protocols using anti tet2
1
Protein Extraction and Western Blot Analysis
2
Immunohistochemical Analysis of Epigenetic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemical analysis was performed as described in our previous study. Briefly, all tumor xenograft sections were deparaffinized with xylene and rehydrated through an alcohol gradient, and then, endogenous peroxidase was inactivated by 0.5% H2O2 for 10 min. Subsequently, the sections were blocked with 5% normal goat serum for 1 h and washed three times with PBS, followed by incubation at 4 °C overnight with one of the following primary antibodies: anti-5-hmC (1:100, Active Motif), anti-5mC (1:100, Active Motif), anti-TET1 (1:300, Abcam), anti-TET2 (1:300, Abcam), anti-TET3 (1:300, Abcam), anti-DNMT1 (1:100, Abcam), anti-DNMT3A (1:500, Abcam), anti-DNMT3B (1:100, Abcam), anti-Ki 67 (1:200, Abcam), and anti-luciferase (1:1000, Abcam). The sections were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature for 1 h and developed with a DAB kit.
3
Protein Expression Analysis by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in cold RIPA buffer. A BCA Protein Assay kit (Thermo Fisher Scientific, Rockford, IL, USA) was used for measure protein concentrations. A total of 60 μg of protein was separated on a 10% SDS-PAGE gel and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After soaked in 5% non-fat milk for 1 h, the membranes were incubated with primary antibody (anti-YTHDC2, 1:1,000 dilution, cat no. EPR21820-49, Abcam, USA; anti -TET2, 1:1,000 dilution, cat no. EPR20546-135, Abcam, USA; anti-MYOCD, 1:1,000 dilution, cat no. MA5-24103, ThermoFisher Scientific, USA; anti-SRF, 1:1,000 dilution, cat no. 720240, Invitrogen, USA; anti-KLF4, 1:1,000 dilution, cat no. PA5-20897, Invitrogen, USA) incubated overnight at 4°C. After washed with PBS for 3 times, the membranes were incubated with secondary antibody for 1 h at 37°C. The ECL developer is developed in the gel imaging system.
4
Quantitative Western Blot Analysis of DNA Repair Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The detailed procedure western blotting was performed as previously reported [7 (link)]. CD4+ T cells were lysed in 1% NP40 lysis buffer [20 mM Tris/HCl (pH 7.2), 200 mM NaCl, 1% NP40] containing proteinase inhibitor (Thermo Pierce). Lysates were centrifuged at 12,000 g for 15 min at 4°C, and protein concentration was detected by the Bradford protein assay (Bio-Rad, CA, USA). Equal amounts of proteins were separated on SDS-PAGE gels and then transferred to PVDF membranes (Bio-Rad, CA, USA). Membranes were blocked with 5% nonfat milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) buffer and immunoblotted with primary antibodies, including anti-HMGB1 (Abcam, MA, USA), anti-TDG (Abcam, MA, USA), anti-AID (Cell Signaling, BSN, USA), anti-TET2 (Abcam, MA, USA), anti-STAT3 (Cell Signaling, BSN, USA), and anti-GAPDH (Santa Cruz, CA, USA). Band intensity was quantified using Quantity One software (Bio-Rad, CA, USA).
5
Nicotine and α-bungarotoxin Immunoassay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nicotine and α-bungarotoxin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Monoclonal antibodies (anti-mouse CD3-FITC, anti-mouse CD4-APC, anti-mouse CD8-PE-cy7, Rat IgG2b K Isotype Control FITC, Rat IgG2b K Isotype Control APC and Rat IgG2a K Isotype Control PE-cy7) and Annexin V/PE Apoptosis Detection kit were purchased from eBioscience (San Diego, USA). Anti-mouse CD95-PE-cy7 was obtained from BD Biosciences (New Jersey, USA). Mouse IgG1 and IgG2a ELISA kits were obtained from MultiSciences (Hangzhou, Zhejiang, China). Mouse IL-4 ELISA kit was obtained from Dakewe Biotech (Shenzhen, Guangdong, China). Anti-a7 nAChR and anti-TET2 were obtained from Abcam (San Diego, USA). Trizol was purchased from Life Technologies (Gaithersburg, MD, USA). Reverse transcription and RT-qPCR kits were purchased from TaKaRa Biotechnology (Dalian, Liaoning, China). RPMI-1640 medium and fetal bovine serum (FBS) were purchased from HyClone (Logan, UT, USA). Caspase-3 Action Detection kit and Caspase-8 Action Detection kit were from Beyotime Biotechnology (Shanghai, China). The TET2 siRNA and all primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The TIANamp Genomic DNA Kit was from TIANGEN Biotech Co., Ltd. (Beijing, China). All chemicals and reagents were analytical grade.
6
TET Protein Expression Analysis by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blot analysis, proteins were extracted from cells using 2× SDS lysis buffer. Protein concentrations were determined using the BCA protein assay kit (TIANGEN, Beijing, China). Proteins were separated on a 10% SDS-polyacrylamide gel and transferred to a PVDF membrane. Then, membranes were blocked with 5% nonfat milk powder in TBS-T (0.1% Tween-20 in PBS) and incubated with primary antibodies overnight at 4°C. The primary antibodies used in the present study were rabbit anti-TET1, anti-TET2, anti-TET3, and mouse anti-GAPDH antibodies (Abcam, Cambridge, U.K.). After washes with PBS-T, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (anti-mouse or anti-rabbit, Invitrogen, Waltham, U.S.A.) for 1 h at room temperature. Then, proteins were visualized using ECL Super Signal reagent (Pierce, Rockford, U.S.A.).
7
Immunoprecipitation and Western Blotting of PSPC1, TET2, and Pluripotency Factors
8
Quantifying Tet2 Knockdown in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tet2 knockdown efficiency was measured by quantitative PCR (qPCR) and western blot [49 (link)]. For qPCR, total RNA was isolated with an RNeasy kit (Qiagen, Chatsworth, CA, USA) and cDNA was made using SuperScript III reverse transcriptase (Invitrogen). qPCR was performed using FastStart Universal SYBR Green Master mix (Roche, Mannheim, Germany) on a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA). Gene expression was normalized to Gapdh. Primers used for qPCR are listed below:
Tet1 forward: GAGCCTGTTCCTCGATGTGG
Tet1 reverse: CAACCCACCTGAGGCTGTT
Tet2 forward: AACCTGGCTACTGTCATTGCTCCA
Tet2 reverse: ATGTTCTGCTGGTCTCTGTGGGAA
Gapdh forward: GTGTTCCTACCCCCAATGTGT
Gapdh reverse: ATTGTCATACCAGGAAATGAGCTT
9
Multi-Marker Flow Cytometry for Immune Cell Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cell surface staining, cells were stained with indicated antibodies in FACS buffer (1% FBS and 0.1% NaN3 in PBS) for 30 mins on ice, washed, and fixed in 1% paraformaldehyde in PBS. Cytofix/Cytoperm kit (BD Bioscience, Franklin Lakes, NJ) was used for intracellular staining. Samples were analyzed with LSR Fortessa (BD Biosciences) and FlowJo (FlowJo LLC, Ashland, OR). The following antibodies were used in this study and were purchased from BD, eBioscience (San Diego, CA), or Biolegend (San Diego, CA): CD19 (clone 6D5), B220 (clone RA-3-6B2), CD25 (PC61), IgM (R6-60), IgD (11–26c.2a), CD43 (S7), CD179α (R3), cKit (2B8), Igκ (187.1), Igμ (Il/41). The following antibodies were used for immunoblotting and ChIP: anti-E2A (Santa Cruz, Dallas, TX; V18), anti-PU.1 (Santa Cruz, T-21), anti-IRF4 (Santa Cruz, M-17) and anti-TET2 (Abcam, United Kingdom;ab124297).
10
Immunohistochemical Analysis of TET Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunohistochemistry (IHC) was performed under standard procedures. For human CRC tissue microarray slides, anti-TET1 (Santa Cruz, USA), anti-TET2 (Abcam, UK), and anti-TET3 (Santa Cruz) were used. miR-506 miRCURY LNA custom detection probes (Exiqon, USA) were used for ISH. The 5’-3’ sequence (enhanced with LNA) was TCCATCATTACCCGGCAGTATTA and possessed a DIG label at both the 5’ and the 3’ends. Hybridization, washing and scanning were performed according to the manufacturer's instructions. The intensity of TET1/2/3 staining was scored as 0–4 according to the following standards: 0–1 (no staining), 1–2 (weak staining), 2–3 (medium staining), and 3–4 (strong staining). The percentage of TET1, TET2 and TET3 in 3 representative high-power fields of individual tumor samples and their normal adjacent samples were analyzed (As showed in Figure 1C ). Those expression scores were equaled to scores of the intensities × the percentages of positive cells. The maximum was 4, and the minimum was 0. Every sample was evaluated by at least 2 pathologists who were blind to the experimental conditions. Expression scores greater than or equal to 2 were defined as high expression, while scores of less than 2 were defined as low expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!