Hcm medium

HUVEC were isolated de novo as previously described [24 (link),25 (link)] and cultured in EGM2 medium (Cambrex); peripheral blood monocytes were isolated from blood buffy coat by cold aggregation [26 ] and cultured in RPMI1640 and 10% fetal bovine serum (FBS); human foreskin fibroblasts were generated from skin biopsies and cultured in Dulbecco’s modified Eagle’s medium (DMEM) + 10% FBS, as previously described [27 (link)]; human astrocytes and hepatocytes were purchased from Lonza and cultured in AGM and HCM medium (Lonza), respectively. Bowes human melanoma cells, Huh7 and HepG2 human hepatoma cells and HT1080 fibrosarcoma cells were obtained from the DSMZ German Collection of Cell cultures and cultured in Dulbecco’s modified Eagle’s medium with 10% FCS; HeLa cervical cancer cells and NB4 acute promyelocytic leukemia cells were from the DSMZ and grown in RPMI, 10% FCS. The identity of all cell lines was authenticated by DNA profiling (performed at the DSMZ) and no rodent mitochondrial DNA sequences could be detected. None of the cells studied had sequence variants in the proximal t-PA gene promoter.

To induce definitive endoderm (DE) differentiation from hiPSCs, both hiPSCs were sequentially cultured in DE differentiation medium I (1% B27 (Gibco, Waltham, MA, USA), 100 ng/mL Activin A (PeproTech, Rockyhill, NJ, USA), and 50 ng/mL Wnt3A (R&D) in RPMI 1640 medium) for 1 d, followed by DE differentiation medium II (2% B27 and 100 ng/mL Activin A in RPMI 1640 medium). DE cells were further incubated in hepatocyte medium (10 ng/mL FGF-2 (PeproTech) and 20 ng/mL BMP4 (R&D) in HCM medium (Lonza, Walkersville, MD, USA)) for 5 days. For inducing hHOs, single cells (10⁴ cells per well) using TrypLE™ Express Enzyme (Gibco) were embedded into Matrigel as 50 μL droplets and cultured in hHO differentiation medium (1% Glutamax, 1% N2, 1% B27, 10 mM HEPES, 1.25 mM N-acetylcysteine, 10 nM gastrin (Sigma), 10 mM nicotinamide, 5 μM A83–01 (Sigma), 10 μM Forskolin (Sigma), 250 ng/mL R-spondin1 (R&D), 100 ng/mL Wnt3A (R&D), and 50 ng/mL EGF (PeproTech) in Advanced DMEM/F12 medium). Media were changed every 2–3 days and hHOs were passaged at 1–2 weeks at a ratio of 1:5–1:8.

Hepatocytes in HCM medium (Lonza, Basel, Switzerland) were treated for 16 h with 10 μM momelotinib in the presence of BMP2 (6.2 μg/mL). ChIP assays were performed based on a protocol previously described [19 (link)]. The qPCR primers were designed according to the location of H3K27Ac and H3K4me1 peaks from ENCODE data. The primer sequences were as follows: Primer 1 F: TTCCAAGAGCCAGCAAACGGG, Primer 1 R: GCAGGGACGGATGGGAAGAAG; Primer 2 F: GCCATCTTGAGTGTGGCAGGG, Primer 2 R: GGCCCAACAACCTTGACTCCA; Primer 3 F: ATTCCTGCCAGGGGCAATGTC, Primer 3 R: ATGTCCCTAAGGGCAGCCCAA; Primer 4 F: AGGCCTGTTGACACCCTCAGA, Primer 4 R: GTGATCCCCTCCCCCACTCTT; Primer 5 F: ATTCAAGGCCATGTCCCCAGC, Primer 5 R: GGAGCAAACCCCAGCTGAACT. Negative Control Primer F: GCCGCGCTTCAACAACAACTT, Negative Control Primer R: TTAATTCGGGACGCCTGGGTG.