Qpcr master mix

Total RNA was isolated from cultured cells and heart tissue with Total RNA Isolation Kit (Vazyme) following the manufacturer’s protocol. First-strand cDNA was synthesized with a cDNA Synthesis Kit (Vazyme). Quantitative real-time PCR was performed using qPCR Master Mix (Vazyme). The targeted gene expression levels were normalized to 18s rRNA level. The following primers were used: Mouse-Ho-1: 5′- CTCTCTTCTCTTGGGCCTCTA -3′, 5′- TGTCAGGTATCTCCCTCCATTC -3′; Mouse-Nox2: 5′- GAAAACTCCTTGGGTCAGCACT -3′, 5′- ATTTCGACACACTGGCAGCA -3′; Rat-Ho-1: 5′- TTTCAGAAGGGTCAGGTGTCC -3′, 5′- CTGCTTGTTTCGCTCTATCTCC -3′; Rat-Nox2: 5′- CCTGTATGTGGCTGTGACTC -3′, 5′- TCAAAGTAAGACCTCCGAATGG -3′; 18s: 5′- CCTGTATGTGGCTGTGACTC -3′, 5′- TCAAAGTAAGACCTCCGAATGG -3′.

The cells were collected and purified using ESscience RNA-Quick Purification Kit (YiShan Biotech, Shanghai, China). The RNA samples were reverse transcribed for mRNA level quantification via qPCR using HiScript III RT SuperMix and qPCR Master Mix (Vazyme). Supplementary Table 1 lists the primers for qPCR. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control for CTGF, MMP9, SPP1, and COX-2 qPCR.

For qRT-PCR, cDNA was synthesized using 1 μg of RNA as a template and purified using a cDNA reverse transcription kit (Takara, Tokyo, Japan) according to the manufacturer’s instructions. The concentration and purity of cDNA was determined by measuring UV absorbance using a NanoDrop 1000 Spectrophotometer. qRT-PCR was performed using Evagreen (Biotium, Fremont, CA, USA) and qPCR Master Mix (Vazyme, Nanjing, Jiangsu, China) on an ABI QuantStudio 6 flex instrument (Thermo Fisher, USA). The primers used to detect gene expression levels were listed in Table S6. Target genes included 21 DEGs associated with oxidative phosphorylation (OXPHOS), mitochondria, replication, translation, and cell growth as well as 12 randomly selected DEGs. The actin gene was used as an internal reference gene. Error bars were used to indicate standard deviation. The concentration of the cDNA template was 20 ng/μL. Relative transcription levels of target genes were calculated using the relative quantitation (2^−ΔΔCT) method [23 (link)]. Three biological replications and technical replications were performed.

RNA from platelets was extracted using the TRIzol reagent according to the standard manufacturer’s recommendations. The SuperMix for qPCR (Vazyme, China) was used to obtain complementary DNA. RT-PCR was performed with qPCR Master Mix (Vazyme, China) and analyzed using the ViiA7 RT-PCR instrument (Applied Biosystems, United States). The reference gene GAPDH was used for the normalization. The primers are listed in Table 2.

The total RNA was isolated with a TRIzol kit (Invitrogen). Reverse transcription of purified RNA was performed using Prime Script™ RT reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed using qPCR Master Mix (Vazyme). GAPDH mRNA level was recognized as an endogenous control for each target gene. Primer sequences are available upon request.

Fetal bovine serum (FBS) was purchased from KeyGEN Biotech Co. Dulbecco’s modified Eagle cell culture medium (DMEM) was purchased from Grace Biotechnology (Nanjing, China). qPCR Master Mix was purchased from Vazyme (Nanjing, China). CCK-8 kit was purchased from Biyotime Biotech Co. LPS, Cocktail protease inhibitors and Alcalase (2.4 L) were all obtained from Sigma-Aldrich Co. (St. Louis, MO, USA). Dextran sodium sulfate (MW: 36,000–50,000) was purchased from YEASEN Biotechnology (Shanghai, China). RIPA Lysate and Bradford protein quantitative kits were purchased from Beyotime Biotech Inc. (Shanghai, China). TNF-α, IL-6, MCP-1, IL-1β, and LPS ELISA kits were purchased from Neobioscience Biological Technology (Shenzhen, China). All other chemicals were of analytical grade.