MCF-7 cells were routinely maintained. Wnt2-5UTR was PCR amplified from genome DNA of mice liver and cloned into plasmid pR-F. Mutations within the conserved stem-loop region of Wnt2-5UTR were introduced by overlap extension PCR. The resulting mutation was confirmed by Sanger sequencing. Twenty-four hours after plasmids transfection, OGD was performed and lasted for 24 h. Luciferase assay was conducted using the luciferase reporting kit (Cat: E1910, Promega) after 8 h’s reoxygenation using GloMax. The ratio of LucF/LucR was used to indicate the activity of IRES. XIAP-5UTR was used as positive control52 (link).
Luciferase reporting kit
Manufactured by Promega
The Luciferase Reporting Kit is a laboratory tool designed to detect and quantify the activity of luciferase, an enzyme commonly used as a reporter in various biological experiments. The kit provides the necessary reagents and protocols to measure luciferase activity, which is often used as an indicator of gene expression or other cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using luciferase reporting kit
1
Regulation of Wnt2 IRES activity
2
In Situ Hybridization and Luciferase Assay of Wnt Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antisense digoxigenin-labeled RNA probes for Wnt2, Wnt7a, Wn9a and Wnt10a were synthesized and in situ hybridization was performed as described previously (Wang et al., 2011b) . All the probes were made by RT-PCR based in vitro transcription. The primer information is as the following: Wnt2: TGTACTCTGAGGACATGCTGGCT, CTTATGTGCAGCAGGTGGTTC; Wnt7a: TCAGCCTGGGCATAGTCTACCTCC, TTCTCCTCCAGGATCTTCCGACCC; Wn9a: CAAGTTTGTCAAGGAGTTCCTGG, TGTTGTTTGTAACCCTGTGCC; Wnt10a: CTGTTCTTCCTACTGCTGCTGGCTGC, ATGTTCTCCATCACCGCCTGCC. After hybridization and incubation with anti-digoxigenin antibody, color was development with HRP mediated reaction.
Luciferase assay of Wnt-5UTR IRES activity. MCF-7 cells were routinely maintained. Wnt2-5UTR was PCR ampli ed from genome DNA of mice liver and cloned into plasmid pR-F. Mutations within the conserved stem-loop region of Wnt2-5UTR were introduced by overlap extension stitch PCR. The resulting mutation was con rmed by Sanger sequencing. Twenty-four hours after plasmids transfection, OGD was performed and lasted for 24h. Luciferase assay was conducted using the luciferase reporting kit (Promega) after 8h's reoxygenation using GloMax. The ratio of LucF/LucR was used to indicate the activity of IRES.
Luciferase assay of Wnt-5UTR IRES activity. MCF-7 cells were routinely maintained. Wnt2-5UTR was PCR ampli ed from genome DNA of mice liver and cloned into plasmid pR-F. Mutations within the conserved stem-loop region of Wnt2-5UTR were introduced by overlap extension stitch PCR. The resulting mutation was con rmed by Sanger sequencing. Twenty-four hours after plasmids transfection, OGD was performed and lasted for 24h. Luciferase assay was conducted using the luciferase reporting kit (Promega) after 8h's reoxygenation using GloMax. The ratio of LucF/LucR was used to indicate the activity of IRES.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!