The largest database of trusted experimental protocols

Alkphos direct labeling and detection kit

Manufactured by GE Healthcare

The AlkPhos Direct Labeling and Detection Kit is a laboratory equipment product designed for direct alkaline phosphatase labeling and detection. It provides a simple and efficient method for labeling biomolecules, such as proteins, with alkaline phosphatase, which can then be detected using appropriate substrates.

Automatically generated - may contain errors

2 protocols using alkphos direct labeling and detection kit

1

Silkworm Genomic DNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Probe DNA was prepared as described in our previous report [26] (link). Genomic DNAs of wild-type (C515), C515-SpA1, C515-SpA2, and C515-EGFP silkworms were prepared from adult moths as follows. First, the adult body was homogenized in 2 mL of homogenization buffer (50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA, 1% SDS and 0.2 mg mL–1 proteinase K); the mixtures were shaken for 1 h at 50°C. After being shaken, the homogenates were extracted once with TE-saturated phenol, once with TE-saturated phenol–chloroform–isoamyl alcohol, and then precipitated with ethanol.
About 5 µg of each genomic DNA were digested with KpnI or HindIII. Digested DNA (2 µg) was applied to 0.8% agarose gel electrophoresis and then blotted onto a Hybond N+ membrane (GE Healthcare). The piggyBac R-arm sequence was then detected with an AlkPhos Direct Labeling and Detection Kit (GE Healthcare), using the PCR-amplified piggyBac R-arm sequence [26] (link), in accordance with the manufacturer's instructions. Signals were detected with an LAS-3000mini compact chemiluminescence system (Fujifilm Corporation).
+ Open protocol
+ Expand
2

Confirming Random Transposon Insertions

Check if the same lab product or an alternative is used in the 5 most similar protocols
Southern blotting was used to test individual colonies and to confirm individual random-insertion events. Briefly, genomic DNA was extracted from individual colonies, and 3 µg was digested using the SacI restriction enzyme (NEB). The resulting fragments were run on a 1% agarose gel overnight at 25 V and 500 mA. The DNA was denatured for 30 min in 1.5 M NaCl, 0.5 M NaOH, and the gel was then neutralized for 30 min in 0.5 M Tris-Cl, pH 7.2, 1 M NaCl. The samples were transferred overnight to a Hybond N membrane (Amersham) via capillary action in 20× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The DNA was then cross-linked to the membrane with UV light using a UV Stratalinker 1800 (Stratagene). A DNA probe against the kanamycin cassette in the transposon was generated by PCR using the primers KanF (5′ CGACTGAATCCGGTGAGAAT 3′) and KanR (5′ CCGCGATTAAATTCCAACAT 3′). The probe was labeled and hybridized to the membrane using an AlkPhos direct labeling and detection kit (GE Healthcare) as per the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!