Sanger sequencing method

Allelic determination of seven housekeeping gene loci (aroA, cpn, dpr, recA, thrA, gki, and mutS) was performed using multilocus sequence typing (MLST), according to a previously published method [23 (link)]. Automatic DNA extraction was performed with the MagNA Pure 96 DNA and Viral NA Small Volume Kit on the MagNA Pure 96 Instrument (Roche Diagnostics International AG, Rotkreuz, Switzerland). PCR products were sequenced by the Sanger sequencing method (Eurofins Genomics, Cologne, Germany) using primers with modifications at the 5′ end to obtain better sequencing results (SEQplus sequencing primers, Generi Biotech, Hradec Králové, Czech Republic).
Identification of alleles and sequence type (ST) assignment were performed using the PubMLST database (https://pubmlst.org/organisms/streptococcus-suis (accessed on 9 November 2022)).

Total RNA from sub-mantle tissues was isolated as described previously34 (link) and reverse transcribed by PCR to cDNA according to the manufacturer’s protocol (Life Technologies). The first strand cDNA was then used as a template along with the primers, AaCP43 F1 :
(5′ ATGCTGCCTGCCGCGATCC) and AaCP43 R1:
(5′ CTACCATTTAGGCTTATAC), to amplify the GSrCP-Aa43-1 transcripts by conducting PCR with the following steps: 95 °C for 30 sec, 56 °C for 1 min and 30 sec, 70 °C for 1 min and 30 sec, for 35 cycles. Resulting 1344 bp DNA fragments were isolated and then sequenced by using Sanger sequencing method (Eurofins MWG Operon; Louisville, KY). The assembled sequence was then aligned with the transcript comp41238_c0_seq1 using Clustal Omega (EMBL-EBI, UK). All RT-PCR related reagents and enzymes were purchased from Life Technologies (Carlsbad, CA) and reagents for DNA isolation were from Qiagen Inc (Valencia, CA).

Total RNA isolated from sub-mantle tissues were reverse transcribed to cDNA according to the manufacturer’s protocol (Life Technologies). The first strand cDNA was then used as a template along with the primers, 114KNcoIF (5′AAAAACCATGGGCATGCTGCGGCTCTCGCTAGC3′) and 114KXhoIR (5′GGGGGCTCGAGGCACTTGAAGTAGTCGTAC3′), to amplify the Aacp114k transcript by conducting PCR. Resulting 3 kb DNA fragments were digested with NcoI and XhoI, followed by cloning into a pET22b vector. The cloned plasmids were propagated in E. coli Top10 in LB culture supplemented with ampicillin. The insert of isolated plasmid was sequenced using the Sanger sequencing method (Eurofins Genomics).