Fastdna spin kit for soil

Manufactured by MP Biomedicals

Sourced in United States, France, Germany, United Kingdom, Australia, Switzerland, Canada, China, Panama, Netherlands, Japan

The FastDNA SPIN Kit for Soil is a product designed for the extraction and purification of DNA from soil samples. The kit provides a fast and efficient method to obtain high-quality DNA from a variety of soil types, which can then be used for downstream molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

1 362 protocols using fastdna spin kit for soil

Upland Rice DNA Extraction from Seeds and Soil

Check if the same lab product or an alternative is used in the 5 most similar protocols

Five gram of surface-sterilized upland rice seeds from each sample was frozen with liquid nitrogen and was quickly ground into a ne powder with a pre-cooled sterile mortar, and then the DNA was extracted using the FastDNA ® SPIN Kit for Soil (MP Biomedicals, Solon, OH, USA) following the manufacturer's instructions of the Kit. Soil total genomic DNA was extracted from fully mixed 20 g of soil using the FastDNA® SPIN Kit for Soil (MP Biomedicals, Solon, OH, USA) following the manufacturer's instructions. The DNA was extracted immediately after sampling in order to maintain uniformity for comparing the bacterial communities.

Wang Z., Zhu Y., Jing R., Wu X., Li N., Liu H., Zhang X., Wang W, & Liu Y. (2021). High-throughput sequencing-based analysis of the composition and diversity of endophytic bacterial community in seeds of upland rice. Archives of microbiology, 203(2).

+ Open protocol

+ Expand

DNA Metabarcoding of Fecal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA metabarcoding was conducted on 3-g faecal subsamples that were processed in three ways prior to DNA isolation:

Untreated faeces: the 3-g subsample was directly transferred to a 50-ml FastDNA™ Spin Kit for Soil (MP Biomedicals™) tube.

Concentrated faeces: three 3-g subsamples were homogenized in 57 ml water and sieved through a ≈ 1000-µm sieve. The suspension was then divided into three 15-ml tubes and centrifuged at 1550 rcf for 3 min, after which the supernatants were discarded. Finally, 300 µg of the remaining pellet was transferred from one of the centrifuge tubes to a 2-ml FastDNA™ Spin Kit for Soil (MP Biomedicals™) tube.

Faecal flotation: the concentrated pellet from one of the centrifuge tubes prepared above in (2) was resuspended in NaCl/ZnCl₂ solution (specific gravity 1.3 g), then vortexed until the pellet was dissolved into a suspension. The suspension was centrifuged again at 1550 rcf, and the supernatant was sieved through filter fabric (SEFAR^® MEDIFAB) with a pore diameter of 10 µm. The filter was washed with a 1% ES 7X™ cleaning solution (MP Biomedicals™) diluted with distilled water, and the wash water was transferred to 50-ml centrifuge tubes. After centrifugation for 10 min at 1550 rcf, the supernatant was carefully discarded and the pellet transferred into a 2-ml FastDNA™ Spin Kit for Soil tube.

Davey M.L., Utaaker K.S, & Fossøy F. (2021). Characterizing parasitic nematode faunas in faeces and soil using DNA metabarcoding. Parasites & Vectors, 14, 422.

+ Open protocol

+ Expand

Faecal Microbiome Profiling in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Faecal samples were collected directly from mice, and immediately stored at -80°C until DNA extraction. DNA was extracted from faecal samples using FastDNA Spin Kit for Soil (MPBio) and stored at -20 °C until metagenomic sequencing. DNA samples were quantified using a Qubit 4 Fluorometer (Thermo Fisher). 16S rRNA amplicon based profiling was performed using the FastDNA Spin Kit for Soil (MP Biomedicals) on 300mg of faecal sample from each mouse. The V1-V2 region of the 16S rRNA genes was amplified with Q5 High-Fidelity Polymerase Kit (New England Biolabs). (F’:AATGATACGGCGACCACCGAGATCTACAC-TATGGTAATT-CC-AGMGTTYGATYMTGGCTCAG; R’:CAAGCAGAAGACGGCATACGAGATACGAGACTGATTAGTCAGTCAGAAGCTGCCTCCCGTAGGAG). Each PCR amplification was performed as four independent amplifications and pooled in equimolar amounts for 150bp paired end sequencing with the Illumina MiSeq platform. For shotgun metagenomic sequencing, samples with >100 ng DNA material proceeded to paired-end (2 × 150 bp) metagenomics sequencing on the HiSeq 4000 platform as per standard manufacturer library preparation and sequencing protocols.

Forster S.C., Clare S., Beresford-Jones B.S., Harcourt K., Notley G., Stares M.D., Kumar N., Soderholm A.T., Adoum A., Wong H., Morón B., Brandt C., Dougan G., Adams D.J., Maloy K.J., Pedicord V.A, & Lawley T.D. (2022). Identification of gut microbial species linked with disease variability in a widely used mouse model of colitis. Nature Microbiology, 7(4), 590-599.

+ Open protocol

+ Expand

Metagenomic Profiling of Murine Gut Microbiome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fecal samples were collected directly from mice and immediately stored at −80 °C until DNA extraction. DNA was extracted from samples using the FastDNA Spin Kit for Soil (MPBio) and stored at −20 °C until metagenomic sequencing. DNA samples were quantified using a Qubit 4 Fluorometer (Thermo Fisher). 16 S rRNA amplicon-based profiling was performed using the FastDNA Spin Kit for Soil (MP Biomedicals) on 300 mg of fecal sample from each mouse. The V1–V2 region of 16 S rRNA genes was amplified with a Q5 High-Fidelity Polymerase Kit (New England Biolabs): F': AATGATACGGCGACCACCGAGATCTACAC-TATGGTAATT-CC-AGMGTTYGATYMTGGCTCAG; R': CAAGCAGAAGACGGCATACGAGATACGAGACTGATTAGTCAGTCAGAAGCTGCCTCCCGTAGGAG. Each PCR amplification was performed as four independent amplifications and pooled in equimolar amounts for 150-base-paired (bp)-end sequencing with the Illumina MiSeq platform. For shotgun metagenomic sequencing, samples with >100 ng of DNA material were processed onward to paired-end (2 × 150 bp) metagenomics sequencing on the HiSeq 4000 platform as per standard manufacturer library preparation and sequencing protocols.

+ Open protocol

+ Expand

Faecal DNA Extraction and Controls

Check if the same lab product or an alternative is used in the 5 most similar protocols

Faecal samples were thawed, and 200 mg of material was processed using the FastDNA Spin Kit for Soil (MP Biomedicals, California, USA). Samples were aliquoted into tubes containing ceramic beads of varying size, processed using a FastPrep-24 5G bead beating machine (MP Biomedicals, California, USA), and subsequently treated following the protocol of the FastDNA Spin Kit for Soil.
In addition to the volunteer samples, the ZymoBiomics Fecal Reference with TruMatrix Technology (Zymo Research, California, USA) was included as a positive control. This was included to control for the consistency and composition of faecal material, and contained a defined bacterial composition. A DNA extraction was also performed on 100 μL of the stabilisation buffer from an unused OMNIGene Gut OMR-200 kit as a negative control, allowing for the detection of contamination from the sampling, extraction kits or procedures. Samples were processed in two batches. A single positive and negative control was included per batch.

Troth T.D., McInnes R.S., Dunn S.J., Mirza J., Whittaker A.H., Goodchild S.A., Loman N.J., Harding S.V, & van Schaik W. (2023). Differences in the gut microbiota between Gurkhas and soldiers of British origin. PLOS ONE, 18(12), e0292645.

+ Open protocol

+ Expand

Fecal and Water Sample DNA Extraction

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the U.S. and Dominican Republic fecal samples, bacterial DNA was extracted from approximately 1 g of material using a QIAmp DNA stool minikit according to the manufacturer’s instructions (Qiagen, Valencia, CA) as described (25 (link)). About 200 mg of Australian stool samples was extracted using the QIAmp stool DNA kit, while about 500 mg of dry fecal sample for French samples was extracted using the FastDNA spin kit for soil (MP Biomedicals, Carlsbad, CA). Australian and French extracted DNA was freeze-dried before being shipped to the United States.
In total, 25 ml for sewage influent and between 200 and 400 ml for freshwater samples was filtered onto 0.22-μm mixed cellulose ester filters with a 47-mm diameter (Millipore, USA). DNA from filters was then extracted using the FastDNA spin kit for soil (MP Biomedicals, Solon, OH) as previously described (26 (link), 36 (link)). DNA concentration was assessed on a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, CA).

Roguet A., Esen Ö.C., Eren A.M., Newton R.J, & McLellan S.L. (2020). FORENSIC: an Online Platform for Fecal Source Identification. mSystems, 5(2), e00869-19.

+ Open protocol

+ Expand

Soil DNA Extraction and Microbial Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Soil DNA extraction was carried out from the watermelon cultivated soils to sterilized buffer (NaCl, 4.25 g; KH₂PO₄, 0.15 g; Na₂HPO₄, 0.3 g; MgSO₄ 0.1 g; gelatin, 0.05 g), mixed, and allowed to stand for 10 minutes. Soil solution was extracted using Fast DNA Spin Kit for soil (MP, Biomedicals, Seoul, Korea): Fast DNA Spin Kit for soil according to the extraction method. A quantitative polymerase chain reaction (qPCR) amplification was conducted after the total DNA extraction from the soil samples. A qPCR amplification of the prokaryotic microbes (16S rRNA genes V4 region) was performed using the forward primer 515F (5′-GTGYCAGCMGCCGCGGTAA-3′) and the reverse primer 806R (5′-GGACTACHVGGGTWTCTAAT-3′) (Bates et al., 2011 (link)). Amplicons were sequenced on Illumina-MiSeq platform (Illumina Inc., San Diego, CA, USA) at SHBIO Technology (Shanghai, China).

Adhikari M., Kim S.W., Kim H.S., Kim K.Y., Park H.B., Kim K.J, & Lee Y.S. (2021). Bacterial Community and Diversity from the Watermelon Cultivated Soils through Next Generation Sequencing Approach. The Plant Pathology Journal, 37(6), 521-532.

+ Open protocol

+ Expand

Multilayer Sediment Profiling for Microbial Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly recovered sediment cores were divided into three layers (near-surface, middle, bottom) of 6 to 10 cm thickness each (Table 1) for DNA extraction and sequence-based analysis. This approach covered the available thermal range of cored sediment, while providing sufficient material for coordinated experiments with other cruise participants, and accommodating temperature fluctuations due to pulsating hydrothermal flows that impact surficial (5 to 10 cmbsf) sediments [14 (link)]. Total DNA was extracted using the FastDNA^TM Spin Kit for Soil (MP Biomedicals), as recommended for marine sediment [35 (link)], following the manufacturer’s protocol. Bacterial and archaeal SSU rRNA hypervariable region 4–5 (V4-V5) amplicons were generated using the 515F-Y (5′‐GTGYCAGCMGCCGCGGTAA-3’) and 926R (5′‐CCGYCAATTYMTTTRAGTTT-3’) primers and customized thermocycling parameters [36 (link)]. Fungal ITS2 region amplicons were generated using the 5.8S‐Fun (5′‐AACTTTYRRCAAYGGATCWCT‐3′) and ITS4‐Fun (5′‐AGCCTCCGCTTATTGATAT-GCTTAART‐3′) primers and customized thermocycling parameters [37 (link)]. All amplicons were generated and sequenced at Georgia Genomics and Bioinformatics Core, University of Georgia, using Illumina MiSeq PE 300 chemistry.

Ramírez G.A., Mara P., Sehein T., Wegener G., Chambers C.R., Joye S.B., Peterson R.N., Philippe A., Burgaud G., Edgcomb V.P, & Teske A.P. (2021). Environmental factors shaping bacterial, archaeal and fungal community structure in hydrothermal sediments of Guaymas Basin, Gulf of California. PLoS ONE, 16(9), e0256321.

+ Open protocol

+ Expand

Soil Metagenomic DNA Extraction and Amplicon Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each sample, genomic DNA was extracted from 500 mg of soil using the FastDNA^TM SPIN kit for soil (MP Biomedicals, USA) following the manufacturer’s instructions. For fungi, the nuclear ribosomal internal transcribed spacer (ITS) region was amplified using ITS1F and ITS4 primers [30 (link)], while for bacteria, the 16S ribosomal DNA (16S) region was amplified using 27F [31 (link)] and 518R primers [32 ]. Amplicon libraries were prepared using primers with a 454 pyrosequencing adaptor and multiple identifier (MID) tag. The PCR program was as follows: 5 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at 55°C, and 40 s at 72°C; and a final extension step of 5 min at 72°C. PCR products were confirmed using gel electrophoresis and purified using the HighPure^TM PCR Product Purification Kit (Roche, Germany). Individual PCR products were quantified using a NanoDrop spectrophotometer (Thermo, USA) and separately pooled for bacteria and fungi. Pyrosequencing was performed with a 454 GS Junior platform (Roche, USA) at ChunLab (Seoul, Korea). DNA was sequenced only in the reverse direction, and data were deposited in the NCBI Sequence Read Archive (SRP046049).

Oh S.Y., Fong J.J., Park M.S, & Lim Y.W. (2016). Distinctive Feature of Microbial Communities and Bacterial Functional Profiles in Tricholoma matsutake Dominant Soil. PLoS ONE, 11(12), e0168573.

+ Open protocol

+ Expand

Soil DNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fresh soil samples were weighed, and 300–350 mg were collected into 1.5 mL tubes for extracting DNA with FastDNA^TM SPIN Kit for Soil (MP Biomedical), according to manufacturer’s instruction. Purity and concentration were measured with a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific). DNA was diluted with sterile Milli-Q water to 10 ng μl^-1 concentration and sequenced at Genomed S.A. (Warsaw, Poland) in 2 bp × 250 bp paired-end technology using the Illumina MiSeq system. Amplification of the hypervariable ITS1 region was performed with Q5 Hot Start High-Fidelity 2× Master Mix accordingly to the manufacturer’s instruction with ITS1Fl2 and 5.8S primers (Schmidt et al., 2013 (link)). Authors are aware that there are more specific primers available and since the ITS1 region introduces more bias through unequal lengths of the amplicons, only forward reads were taken for the analysis. Raw FastQ files (both forward and reverse) were deposited in the NCBI SRA database (Table 3).

Grządziel J, & Gałązka A. (2019). Fungal Biodiversity of the Most Common Types of Polish Soil in a Long-Term Microplot Experiment. Frontiers in Microbiology, 10, 6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!