Qiamp dna ffpe tissue kit

The multinodular goiter formalin-fixed paraffin embedded (FFPE) block was sliced at 10 μm thickness and micro-dissected with a surgical blade based on the pathologist review of the biopsy. The scraped tissue was used for DNA extraction using the QIAmp DNA FFPE Tissue kit (Qiagen) as per manufacturer's protocol. DNA was amplified using a series of primers designed to amplify DICER1 hotspots for FFPE DNA. If bands were observed, the resulting PCR was sent for Sanger sequencing by Genome Québec using the same primers that were used in the PCR.

EpiSwitch^® 3D libraries, chromosome conformation analytes converted to sequence-based tags, were prepared from frozen whole blood samples. Using EpiSwitch^® protocols following the manufacturer’s instructions for EpiSwitch^® Explorer Array kits (Oxford BioDynamics Plc, Oxford, UK), samples were processed on the Freedom EVO 200 robotic platform (Tecan Group Ltd., Männedorf, Switzerland). Briefly, 50 µL of whole blood was diluted and fixed with a formaldehyde containing EpiSwitch buffer. Density cushion centrifugation was used to purify intact nuclei. Following a short detergent-based step to permeabilise the nuclei, restriction enzyme digestion and proximity ligation were used to generate the 3D libraries. Samples were centrifuged to pellet the intact nuclei before purification with an adapted protocol from the QIAmp DNA FFPE Tissue kit (Qiagen, Hilden, Germany) Eluting in 1x TE buffer pH7.5. The 3D libraries were quantified using the Quant-iT™ Picogreen dsDNA Assay kit (Invitrogen, Waltham, MA, USA) and normalised to 5 ng/mL prior to interrogation by PCR.

The patients with newly diagnosed primary GBM selected in this study were given standard care treatment (the so-called Stupp protocol) and followed up for at least 18 months. These patients form a cohort included in a French multicentre study that compared five techniques (MS-PCR, MS-HRM, PSQ, MethyLight and immunohistochemistry) for assessing MGMT status [10 (link)]. The protocol was approved by the Rennes medical ethics committee and informed consents were obtained from the patients. Tumor samples obtained during surgery were stored at −80 °C, and only samples containing at least 60 % of tumor cells were processed for DNA extraction. Bisulfite modification of DNA was performed using the EZ DNA methylation Gold kit according to the specified protocol (Zymo Research, Orange, CA). DNA extracted from peripheral blood mononuclear cells and from primary cell lines were used as non-methylated and methylated controls, respectively. For the independent cohort of validation, DNA was extracted from FFPE tissues with the QIAmp DNA FFPE tissue kit (Qiagen, Courtaboeuf, France).

DNA was extracted from FFPE material using the QIAmp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany). Molecular inversion probe analysis (MIP; Oncoscan, ThermoFisher, Waltham, MA, USA) and/or human SNP-6 array (ThermoFisher) and data-mining utilizing Nexus Copy Number 7·0 Discovery Edition software (BioDiscovery, El Segundo, CA, USA) was performed as previously described [10 (link)].

For pTERT-specific mutation analysis studies, the first step was DNA extraction from paraffin-embedded tissue. The material was extracted with the Qiamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany), and fluorometric quantification was performed with Qubit (ThermoFisher Scientific, Waltham, MA, USA). To identify the most prevalent mutations (C228T and C250T), specific polymerase chain reactions were performed with primers F: 5’CCCACGTGCGCAGCAGGAC and R: 5’CTCCCAGTGGATTCGCGGGC from Merck (Darmstadt, Germany) and subsequent Sanger sequencing for mutation identification. Chromatograms were analyzed with FinchTV software version 1.5.0 (Geospiza Inc., Denver, CO, USA).

DNA was extracted from the FFPE specimens using a Qiamp DNA FFPE tissue Kit (Qiagen, Tokyo, Japan) according to the manufacturer’s instructions. KRAS codon 12,13 mutations were measured by direct-sequencing method, as previously described [6 (link)].