Quantitative real-time PCR SYBR green assay sequences
miRbase ID | Mature miRNA sequence (5′ → 3′) | miRbase accession | GeneGlobe ID |
---|---|---|---|
hsa-miR-143-3p | UGAGAUGAAGCACUGUAGCUC | MIMAT0000435 | YP00205992 |
cel-miR-39-3p | UCACCGGGUGUAAAUCAGCUUG | MIMAT0000010 | YP00203952 |
The MiRCURY LNA SYBR Green PCR Kit is a real-time PCR assay for the detection and quantification of microRNA (miRNA) expression. The kit utilizes locked nucleic acid (LNA) technology to enable sensitive and specific detection of miRNA targets.
Quantitative real-time PCR SYBR green assay sequences
miRbase ID | Mature miRNA sequence (5′ → 3′) | miRbase accession | GeneGlobe ID |
---|---|---|---|
hsa-miR-143-3p | UGAGAUGAAGCACUGUAGCUC | MIMAT0000435 | YP00205992 |
cel-miR-39-3p | UCACCGGGUGUAAAUCAGCUUG | MIMAT0000010 | YP00203952 |
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!