Rneasy mini

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Japan, Netherlands, Norway, Canada, France

The RNeasy Mini is a laboratory equipment product designed for the extraction and purification of high-quality RNA from a variety of sample types. It utilizes a silica-based membrane technology to efficiently capture and purify RNA, making it suitable for downstream applications such as gene expression analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNeasy RNA Mini Kit (50 citations) RNeasy mini purification kit (36 citations) RNeasy Universal Mini Kit (32 citations) RNeasy Plus Mini RNA isolation kit (17 citations) RNeasy Mini Handbook (10 citations) RNeasy Total RNA Mini Kit (10 citations) QIAmp RNeasy Mini Kit (5 citations) RNeasy Plus Mini kit columns (5 citations) RNeasy Mini Kit with on-column DNaseI digestion (4 citations) RNeasy Mini Kit RNA Extraction Kit (4 citations)

299 protocols using rneasy mini

PrimPol Knockout Verification in MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from wild-type and PrimPol^Δ/Δ mouse embryonic fibroblasts (MEFs) using RNeasy mini (Qiagen). cDNA library was synthesized by Invitrogen Superscript III kit and oligo dT primers. A nested PCR was performed on the cDNA spanning exon 1–15 (fwd GCT CTG GTT CCC GCC ATC TCT, rev CTT TCT CTC CAG GCT CTG GGA CA) followed by a nested primer set spanning exon 3–14 (fwd TGG CCA AGC CAG AAG AAC CAT CCT, rev CGT CAT CCC AGG CAG CGG CA). Subsequently, the cDNA was cut using MscI enzyme (Thermo Scientific), verifing the CCAA deletion. The deletion removed the MscI site in the wild-type allele.
For qPCR total RNA was isolated from wild-type and PrimPol^Δ/Δ MEFs using RNeasy mini (Qiagen). cDNA library was synthesized using Invitrogen Superscript III kit and random hexamer oligos. qPCR was performed with Fast SYBR® Green Master Mix (Thermo Scientific) and the LightCycler 480II (Roche). Normalization was performed to GAPDH (fwd: CAA TGA CCC CTT CAT TGA CC, rev: GAT CTC GCT CCT GGA AGA TG). PrimPol mRNA was amplified with primers specific for the exon-junction 4–5 (fwd: GAG TGC AAA AGG GGA AAT GG, rev: ATA ACT TCA TAG CAG TGC AAG AG) and the exon-junction 8–9 (fwd: CTA TCT TCC CTG GTG AGC AAT, rev: CTG AAG TGC CAG TAC TGT TAA A).

Pilzecker B., Buoninfante O.A., Pritchard C., Blomberg O.S., Huijbers I.J., van den Berk P.C, & Jacobs H. (2016). PrimPol prevents APOBEC/AID family mediated DNA mutagenesis. Nucleic Acids Research, 44(10), 4734-4744.

+ Open protocol

+ Expand

Quantifying Gene Expression Changes in Spinal Cord Injury

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cord samples were immediately removed after rats were sacrificed at 1 hour, 8 hours, and 3 days after SCI and frozen on dry ice powder. Spinal cord segments were homogenized in ice-cold Trizol. Chloroform was added, and the aqueous phase was collected after centrifugation. RNA extraction was done according to the manufacturer’s protocol (Qiagen RNeasy Mini, Qiagen, Valencia, CA, USA). RNA quality was detected using Agilent Bioanalyzer (Agilent, Palo Alto, CA, USA) in that all samples should show sharp ribosomal RNA bands. One mg of total RNA was used for first-strand cDNA production with Super Script II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) primed by Oligo dT. The real-time quantitative polymerase chain reaction (RT-qPCR) was performed on an Applied Biosystems 7900HT machine, and 10 ng of cDNA, 50 nM of primers, and SYBR Green master mix (Applied Biosystems, Foster City, CA, USA) was used. Expression levels of each target gene were normalized to the mean critical threshold (CT) values of the β-actin housekeeping gene using the 2^-ΔΔCt method (Livak and Schmittgen, 2001) to calculate the relative amount of RNA. The primers used are shown in Table 2.

Yao X., Zhang Y., Hao J., Duan H.Q., Zhao C.X., Sun C., Li B., Fan B.Y., Wang X., Li W.X., Fu X.H., Hu Y., Liu C., Kong X.H, & Feng S.Q. (2019). Deferoxamine promotes recovery of traumatic spinal cord injury by inhibiting ferroptosis. Neural Regeneration Research, 14(3), 532-541.

+ Open protocol

+ Expand

RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using the Qiashredder and Qiagen RNeasy Mini kits (Qiagen) according to the manufacturer's protocol. A unit of 1–2 μg total RNA was used for each reverse transcription reaction performed using the TaqMan RT kit (Applied Biosystems, Grand Island, NY, USA). Primer pairs were designed for target transcripts using Primer Express 3.0 (Applied Biosystems). Quantitative PCR reactions were performed using the Power SYBR Green PCR Master Mix (Applied Biosystems). Reactions were run and analyzed on a ViiA 7 (Life Technologies) qPCR instrument using absolute quantification settings. mRNA levels were normalized to ACTB internal control levels, and differences computed between samples using the ΔΔCt method. Primers used are in Supplementary Information.

Hayano M., Yang W.S., Corn C.K., Pagano N.C, & Stockwell B.R. (2015). Loss of cysteinyl-tRNA synthetase (CARS) induces the transsulfuration pathway and inhibits ferroptosis induced by cystine deprivation. Cell Death and Differentiation, 23(2), 270-278.

+ Open protocol

+ Expand

RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from 50 to 100 embryos at 30 hpf using the QIAGEN RNeasy Mini or Midi Kits (QIAGEN, Germantown, MD), including 1% b-mercaptoethanol, and DNase I treatment. cDNA was synthesized using 1 mg of RNA and SuperScript TM Reverse Transcriptase III protocol (Invitrogen -Life Technologies, Carlsbad, CA) according to the manufacturer instructions.

Arnold C.R., Lamont R.E., Walker J.T., Spice P.J., Chan C.K., Ho C.Y, & Childs S.J. (2015). Comparative analysis of genes regulated by Dzip1/iguana and hedgehog in zebrafish. Developmental dynamics : an official publication of the American Association of Anatomists, 244(2).

+ Open protocol

+ Expand

Transcriptomic Profiling of Bladder Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Harvested tumors were minced and manually dissociated using a 40 µm cell strainer. Tumor cells were flash frozen in liquid nitrogen and stored at −80 °C until processed. RNA was isolated from 6 x 10⁶ homogenized cells by using QIAshredder and RNeasy^® Mini Qiagen kits (Hilden, Germany). RNA concentrations were quantified using a Qubit^® RNA HS Assay Kit (ThermoFisher Scientific, Waltham, MA, USA). Quality was assessed before sequencing using an RNA 6000 Nano kit run on an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA). cDNA libraries were prepared from 100 ng of total isolated RNA per manufacturer specification from BL0293/BL0440 in vivo tumors or in vitro 5637 bladder cancer cells for RNA sequencing using Illumina TruSeq RNA Library Preparation kit version 2.0 (Illumina Inc., San Diego, CA, USA) and run on an Illumina Nextseq 500 using the High Output 75 cycles kit (Illumina Inc., San Diego, CA, USA).

Martin K.A., Hum N.R., Sebastian A., He W., Siddiqui S., Ghosh P.M., Pan C.X., de Vere White R, & Loots G.G. (2019). Methionine Adenosyltransferase 1a (MAT1A) Enhances Cell Survival During Chemotherapy Treatment and is Associated with Drug Resistance in Bladder Cancer PDX Mice. International Journal of Molecular Sciences, 20(20), 4983.

+ Open protocol

+ Expand

Quantifying NHSL1 Expression in Murine Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

The murine multiple tissue northern blot (Ambion) was probed with a 650 bp NHSL1 fragment covering GST-NHSL1-6 (Fig. 1A,E) according to manufacturer's instructions.
For Fig. 2B RNA was extracted from cells using the RNeasy Mini Qiagen kit. cDNA was prepared using Superscript IV (Invitrogen) and expression levels of NHSL1 quantified using standard curves relative to GusB using gene specific primers (PrimeTime qPCR primer assays, IDT): GusB: Mm.PT.39a.22214848 (primer 1: ACCACACCCAGCCAATAAAG; primer 2: AGCAATGGTACCGGCAG)

Law A., Jalal S., Pallett T., Mosis F., Guni A., Brayford S., Yolland L., Marcotti S., Levitt J.A., Poland S.P., Rowe-Sampson M., Jandke A., Köchl R., Pula G., Ameer‐Beg S., Stramer B., & Krause M. (2020). Nance-Horan Syndrome-like 1 protein negatively regulates Scar/WAVE-Arp2/3 activity and inhibits lamellipodia stability and cell migration.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (1 µg) was extracted from cultured cells using an RNA extraction kit (RNeasy Mini; Qiagen) and used to synthesize cDNA (ThermoScript PT-PCR System; Invitrogen). PCR amplification was performed in a total volume of 50 µl containing 2 µl of cDNA, 2mM MgCl2, 200 mM dNTP Mix, 0.2 mM each of 5′- and′-primers, and 1U of Platinum Taq DNA polymerase (Invitrogen). The two-step quantitative real time PCR (qPCR) using TaqMan reagents was performed according to manufacturer’s protocol (Applied Biosystems).

Yamaguchi J., Mino-Kenudson M., Liss A.S., Chowdhury S., Wang T.C., Fernández-del Castillo C., Lillemoe K.D., Warshaw A.L, & Thayer S.P. (2016). Loss of Trefoil Factor 2 From Pancreatic Duct Glands Promotes Formation of Intraductal Papillary Mucinous Neoplasms in Mice. Gastroenterology, 151(6), 1232-1244.e10.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with RNeasy Mini as directed by the manufacturer’s instructions (QIAGEN). cDNA was prepared with a Maxima First Strand cDNA Synthesis Kit (Thermal Scientific Inc), and the QRTPCR mixtures were prepared with SYBR Green PCR Master Mix (Thermal Scientific Inc). QRTPCR reactions were performed on a 7500 Fast Real-time PCR System (Applied Biosystems) and by using the Quantitation-comparative C_T setting. The QRTPCR thermal cycling program included 40 cycles, and each cycle consisted of enzyme activation for 2 min at 95°C, denaturation for 30 sec at 95°C, annealing for 30 sec at 60°C, and extension for 30 sec at 70°C; primer sequences are listed in Table 1. Duplicate measurements were performed for each analysis and were normalized to the endogenous level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.

Yang L., Geng Z., Nickel T., Johnson C., Gao L., Dutton J., Hou C, & Zhang J. (2016). Differentiation of Human Induced-Pluripotent Stem Cells into Smooth-Muscle Cells: Two Novel Protocols. PLoS ONE, 11(1), e0147155.

+ Open protocol

+ Expand

Quantifying Expression of Cell Proliferation and Apoptosis Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on results of MTT assay, after treating the test cells with the combination of 20 nM EE and 90 nM LNG, and control cells with the normal medium for 48h, the total RNA was isolated using RNeasy Mini, RNA isolation kit (Qiagen, Germany) according to manufacturer’s instructions. RNA concentration was measured by Nanodrop 2000c spectrophotometer (Thermo Scientific, USA), and cDNA were synthesized by cDNA Synthesis Kit (Bio FACT, Daejeon, South Korea). The changes in mRNA expression of MKI67, BAX, Bcl2 genes and Beta-2-microglobulin (β2M), as internal control, were estimated by quantitative reverse transcriptase PCR (qRT-PCR) in a rotor gene 6000 Corbett (Corbett Research, Sydney, Australia) detection system SYBR GREEN® (nonspecific DNA-binding factors). The primer sequences are provided in Table-1. Alterations of gene expression of KI67, BAX, and Bcl2 compared with β2M were normalized by LinReg software (Linreg version 2012.1, Amsterdam, the Netherlands). Expression levels of the mentioned gens were quantified by REST program (Relative Expression Software Tool, Qiagen, Germany).

Hedayati M., Rajabi S, & Nikzamir A. (2020). Papillary Thyroid Cancer-Promoting Activities of Combined Oral Contraceptive Components. Galen Medical Journal, 9, e1648.

+ Open protocol

+ Expand

Quantification of Syndecan-4 mRNA by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using RNeasy mini (74106, Qiagen Nordic, Oslo, Norway), as previously described [20 (link)]. In brief, reverse transcription and cDNA synthesis were performed with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Pre-designed TaqMan assays (Rn00561900_m1 and Rn06291926_g1) were used with TaqMan Universal PCR Master Mix (#4304437, both from Applied Biosystems, Foster City, CA, USA) to quantify syndecan-4 mRNA levels by qRT-PCR. Results were detected on the QuantStudio 3 Real-Time PCR System (Applied Biosystems). mRNA data were normalized to expression of ribosomal protein L4 (Rpl4).

Strand M.E., Vanhaverbeke M., Henkens M.T., Sikking M.A., Rypdal K.B., Braathen B., Almaas V.M., Tønnessen T., Christensen G., Heymans S, & Lunde I.G. (2023). Inflammation and Syndecan-4 Shedding from Cardiac Cells in Ischemic and Non-Ischemic Heart Disease. Biomedicines, 11(4), 1066.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!