Cdna reverse transcription kit

Total RNA was extracted from HVT cell pellets using a High Pure RNA Isolation Kit (OMEGA bio‐tek, Norcross, GA, USA), according to the manufacturer's instructions. The first strand of cDNA synthesis from RNA template was performed with cDNA reverse transcription kit (Thermo, Logan, UT, USA), according to manufacturer's instructions. The sequences of the primers used in this study were listed as follows: for α‐hCG, forward primer AACCCATTCTTCTCCCAGCC, reverse primer GCCGTGTGGTTCTCCACTTT; for β‐hCG, forward primer ATGTGCGCTTCGAGTCCATC, reverse primer GGGCCTTTGAGGAAGAGGAG; for angiogenin, forward primer CCTGACCTCACCCTGCAAAG, reverse primer GCTCGGTACTGGCATGGAG; for CXCR4, forward primer TCATCACGCTTCCCTTCTGG, reverse primer CCACCTTTTCAGCCAACAGC.

Hep-2 cells were added into a 48-well plate with 1 × 10⁵ cells one day prior to being infected with 6000 PFU of RSV–Luc in the presence of various compounds or combined compound concentrations. Before being added to each plate, all set compound/compounds dilutions were incubated with viral suspension in an incubator at 37 °C for 5 min. Plates were incubated at 37 °C for 48 h, and total RNA in cells was extracted using the QIAamp viral RNA minikit (Qiagen). RNA was reverse-transcribed using the cDNA reverse-transcription kit (Thermo) with random primers.
Quantitative real-time PCR (qRT–PCR) analysis was performed to amplify SH–G (F: TGCAAACCACCATCCATA; R: CCTAGTTCATTGTTATGA) intergenic region using the cDNA as the template and GAPDH (F: CCATGTTCGTCATGGGTGTGAACCA; R: GCCAGTAGAGGCAGGGATGATGTTC) cDNA as the internal standard. The relative number of viral RNA copies was calculated using the 2−ΔΔCt method. Each experiment was repeated in triplicate, and different inhibitions were calculated by fitting to the sigmoidal curve equation (Graphpad software 8.0).

Differentially expressed transcripts between the three samples identified by RNA-Seq were confirmed by RT-qPCR to validate gene expression. Fifteen NAC genes (Table 4) and other representative DEGs (Table 5) were used. cDNA was prepared using a cDNA reverse transcription kit (Thermo Fisher). Forward and reverse primers were designed for these genes, and the elongation factor 2 gene was used as the reference gene. Three biological replicates were used for each sample. Among the identified NAC TFs, 15 were validated by RT-qPCR. The PrimeScript™ 1st strand cDNA synthesis kit (Takara Bio) was used for cDNA conversion. The 25S rRNA gene was used as a reference for the expression analysis of NAC genes. All RT-qPCR experiments were performed using the Rotor-GeneQ Qiagen Real-Time PCR system (Qiagen, Hilden, Germany) and QuantiNova™ SYBR Green PCR Kit(Qiagen). Relative quantification was performed using thedelta-delta Ct normalization method [72 ] and log₂fold change (Log₂FC).

Total RNA was isolated using RNeasy kit (Qiagen), DNase I digestion to remove genomic DNA was performed. cDNA was synthesised using cDNA Reverse Transcription kit (Thermo Fisher Scientific, Massachusetts, USA). Quantitative RT-PCR was performed using Applied Biosystems 7500 Real-Time PCR Systems and SYBR Green PCR master mix (Thermo Fisher Scientific, Massachusetts, USA). All reactions were performed at least in triplicates and the amplification signal from the target gene was normalised to GAPDH. PCR conditions were: 50 °C 2 min, 95 °C 10 min, 40 × cycles of 95 °C 15 s, 60 °C 1 min and 72 °C 7 s. The list of primers is shown in Supplementary Table S1.

Pellet for RNA purification was prepared by washing organoids twice with PBS (Sigma-Aldrich, D8537, USA) in a 15 ml falcon tube and centrifugated at 400 x g for 5 min. To ensure dissociation, 2 ml TrypLE (Gibco, 12604013, USA) was added to the 15 ml falcon tube for 10 min at 37°C. 350 µl buffer RL (Norgen biotek, #17250, Canada) was then added, and the cells were lysed by vortexing for 15 sec, followed by the addition of 200 µl 96-100% ethanol. The RNA purification kit (Norgen biotek, #17250, Canada) was used to purify the RNA sample, according to the manufacturer’s instructions. Briefly, RNA was washed three times using washing solution A, and the RNA was collected using the elution solution from the RNA purification kit. Nanodrop 2000 Spectrophotometer (Thermo Fisher, USA) was used to measure the RNA concentration. RNA was stored in a -80°C freezer until cDNA synthesis using the cDNA reverse transcription Kit (Thermo Fisher, #4368814, USA), according to the manufacturer’s instructions. Briefly, RNA was mixed on ice with a master mix containing deoxynucleotide triphosphates, reverse transcriptase buffer, random primers, and MultiScribe™ Reverse Transcriptase. Mastercycler Nexus Thermal Cycler GSX1 (Eppendorf, Germany) was used to synthesize cDNA.

The lung cell lines A549 (CCL-185™) and H1975 (CRL-5908™), H460 (HTB-177TM) and the normal human bronchial epithelial cell line BEAS-2B (CRL-9609 ™) were acquired from the American Type Culture Collection. The cells were cultured in RPMI 1640 medium (Gibco, C11875500BT). The media were supplemented with 10% heat-inactivated fetal bovine serum (Gibco, 10099-141) and 1% penicillin–streptomycin (Gibco, 15070063). The cells were kept in an incubator at 37 °C and 5% CO₂. We extracted total RNA from the three cell lines using TRIzol™ reagent (Ambion, 15596-026). cDNA was produced using a cDNA reverse transcription kit (Thermo Fisher Scientific, EP0751). The cDNA was used as the template, and glyceraldehyde 3-phosphate dehydrogenase was used as the internal reference for quantitative reverse transcription polymerase chain reaction (qRT-PCR). According to the manufacturer's guidelines (Yeasen Biotechnology, 10222ES60), a standard two-step PCR amplification procedure was performed. The relative expression of the genes was calculated using the 2^−ΔΔCT method; the primers are listed in Table S4.