Log In Sign up
The largest database of trusted experimental protocols

Minipreps

Manufactured by Qiagen
Visit Supplier

Minipreps is a laboratory equipment used for the small-scale purification of plasmid DNA from bacterial cultures. It is a rapid and efficient method for isolating high-quality plasmid DNA for various applications, such as DNA sequencing, cloning, and transfection.

Automatically generated - may contain errors

Lab products found in correlation

Phosphonucleotide kinase, by New England Biolabs (2 mentions) T4 ligase buffer, by New England Biolabs (2 mentions) Dbh10 βelectrocompetent cells, by New England Biolabs (2 mentions) Lb amp, by Qiagen (2 mentions) T4 ligase, by New England Biolabs (2 mentions) Maxiprep kit, by Thermo Fisher Scientific (2 mentions) Qiaquick gel extraction kit, by Qiagen (2 mentions) Ampure xp bead, by Beckman Coulter (2 mentions) Picogreen, by Thermo Fisher Scientific (2 mentions) Miseq sequencer, by Illumina (2 mentions) Nextera kit, by Illumina (2 mentions) Zymo spin column, by Zymo Research (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Taq dna ligase, by New England Biolabs (1 mentions) Xl10 gold bacteria, by Agilent Technologies (1 mentions) Q5 polymerase, by New England Biolabs (1 mentions) Novablue, by Merck Group (1 mentions) Rosetta 2 de3 plyss, by Merck Group (1 mentions) Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (1 mentions) Gotaq polymerase, by Promega (1 mentions)

Close spelling variants of this product

QIAprep Turbo Miniprep Kit RNEasy MiniPrep RNA Isolation Columns Spin Miniprep Kit Endotoxin free 96 well miniprep kit QIAprep Spin Plasmid Miniprep Kit RNAeasy lipid Miniprep kits QIAamp Viral RNA MiniPrep kit TheQIAprep Spin Miniprep Kit QIAprep spin miniprep columns RNeasy Plant Miniprep Kit

13 protocols using minipreps

1

Lentiviral Vector Construction and Validation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The previously described
lentiviral backbone, RP172, was used to make all lentiviral vectors.80 (link) PCR, using the primers in Table S2, was used to install SphI and PacI restriction sites
surrounding the viral vector. The resulting DNA could be digested
using SphI (NEB) and PacI (NEB) and ligated using instant sticky-end
ligase master mix (NEB) to RP172 backbone also digested with SphI
(NEB) and PacI (NEB). Ligated vectors were then transformed into stable
competent E. coli (NEB), to decrease
plasmid instability, and selected for on 100 μg/mL ampicillin
LB agar plates at 37 °C. A period of 16–24 h later, six
clones were picked and transferred into LB media containing 100 μg/mL
ampicillin for another 24 h at 37 °C. Following minipreps (Qiagen),
the DNA sequence of the lentiviral vector was confirmed using Sanger
sequencing.
McCord K.A., Wang C., Anhalt M., Poon W.W., Gavin A.L., Wu P, & Macauley M.S. (2024). Dissecting the Ability of Siglecs To Antagonize Fcγ Receptors. ACS Central Science, 10(2), 315-330.
+ Open protocol
+ Expand
2

Cloning SaCas9 sgRNA Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pAAV1-FLEX-SaCas9-sgRNA plasmid was digested overnight with BsaI-HFv2 and gel purified (Qiaquick Gel Extraction Kit, QIAGEN). The ordered sgRNA oligos were resuspended to a concentration of 100uM. The oligos were phosphorylated at 37°C for 30min using the following reaction: 1uL of each 100uM oligo, 1uL T4 ligase buffer (NEB), 0.5uL phosphonucleotide kinase (PNK, NEB) and 6.5uL H2O. To anneal the oligos, the entire reaction was placed at 100°C for 5 minutes and allowed to slowly return to room temperature. 50ng of digested pAAV-FLEX-SaCas9-sgRNA and 1uL T4 ligase (NEB) were added directly to the reaction and incubated at room temperature for 2 hours. 2uL of the reaction was electroporated using DBH10 βelectrocompetent cells (NEB). Colonies were grown in LB + AMP and minipreps (QIAGEN) were performed to extract DNA. A restriction digest using BsaI-HFv2 and HindIII-HF was performed to screen for positive colonies. One positive colony was selected and the DNA was extracted using a maxiprep kit (Invitrogen). The insertion of the sgRNA was confirmed via Sanger sequencing (Genewiz) using the following primer: 5′ GACTATCATATGCTTACCGT 3′.
Hunker A.C., Soden M.E., Krayushkina D., Heymann G., Awatramani R, & Zweifel L.S. (2020). Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Cell reports, 30(12), 4303-4316.e6.
+ Open protocol
+ Expand
3

High-Throughput Sequencing of Evolved Phage

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR fragments containing evolved phage with ~500 bp of flanking sequence on either end were amplified from minipreps (Qiagen) of cells infected with evolved phage pools using the following primers: HTSFwd – 5′-TGAAAATATTGTTGATGCGCTGGCAGTGTTC-′3, HTSRev – 5′-TAGCAGCCTTTACAGAGAGAATAACATAAAA-′3. HTS preparation was performed as previously reported20 (link) using a Nextera kit (Illumina). Briefly, 4 μL of amplified DNA (2.5 ng/μL), 5 μL TD buffer, and 1 μL TDE1 were mixed together and heated at 55 °C for 5 min to perform “tagmentation”. Following DNA clean up using a Zymo-Spin column (Zymo), samples were amplified with Illumina-supplied primers according to the manufacturer’s instructions. The resulting products were purified using AMPure XP beads (Agencourt), and the final concentration of DNA was quantified by qPCR using PicoGreen (Invitrogen). Samples were sequenced on a MiSeq Sequencer (Illumina) using 2×150 paired-end runs according to the manufacturer’s protocols. Analysis of mutation frequency was performed using MATLAB as previously described20 (link). Observed background mutation frequencies were subtracted from the mutation frequencies of each experimental sample to account for DNA sequencing errors20 (link).
Hubbard B.P., Badran A.H., Zuris J.A., Guilinger J.P., Davis K.M., Chen L., Tsai S.Q., Sander J.D., Joung J.K, & Liu D.R. (2015). Continuous directed evolution of DNA-binding proteins to improve TALEN specificity. Nature methods, 12(10), 939-942.
+ Open protocol
+ Expand
4

Isolation and Sequencing of EgAgB Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids from EgAgB positive clones expressed from pINQ-HAH6 were isolated by performing minipreps (QIAGEN). Their sequences were obtained by Sanger sequencing by Macrogen (Korea) and manually aligned.
Folle A.M., Lagos Magallanes S., Fló M., Alvez-Rosado R., Carrión F., Vallejo C., Watson D., Julve J., González-Sapienza G., Pristch O., González-Techera A, & Ferreira A.M. (2024). Modulatory actions of Echinococcus granulosus antigen B on macrophage inflammatory activation. Frontiers in Cellular and Infection Microbiology, 14, 1362765.
+ Open protocol
+ Expand
5

Cloning SaCas9 sgRNA Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pAAV1-FLEX-SaCas9-sgRNA plasmid was digested overnight with BsaI-HFv2 and gel purified (Qiaquick Gel Extraction Kit, QIAGEN). The ordered sgRNA oligos were resuspended to a concentration of 100uM. The oligos were phosphorylated at 37°C for 30min using the following reaction: 1uL of each 100uM oligo, 1uL T4 ligase buffer (NEB), 0.5uL phosphonucleotide kinase (PNK, NEB) and 6.5uL H2O. To anneal the oligos, the entire reaction was placed at 100°C for 5 minutes and allowed to slowly return to room temperature. 50ng of digested pAAV-FLEX-SaCas9-sgRNA and 1uL T4 ligase (NEB) were added directly to the reaction and incubated at room temperature for 2 hours. 2uL of the reaction was electroporated using DBH10 βelectrocompetent cells (NEB). Colonies were grown in LB + AMP and minipreps (QIAGEN) were performed to extract DNA. A restriction digest using BsaI-HFv2 and HindIII-HF was performed to screen for positive colonies. One positive colony was selected and the DNA was extracted using a maxiprep kit (Invitrogen). The insertion of the sgRNA was confirmed via Sanger sequencing (Genewiz) using the following primer: 5′ GACTATCATATGCTTACCGT 3′.
Hunker A.C., Soden M.E., Krayushkina D., Heymann G., Awatramani R, & Zweifel L.S. (2020). Conditional Single Vector CRISPR/SaCas9 Viruses for Efficient Mutagenesis in the Adult Mouse Nervous System. Cell reports, 30(12), 4303-4316.e6.
+ Open protocol
+ Expand
6

Introducing Synonymous Mutations in RB1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GFP-RB plasmid (Addgene, 16004) was mutated using PCR by introducing 4 synonymous mutations into phosphorylated primers targeting the RB1 sequence recognized by the gRNA. Q5 polymerase (NEB, M0491) and Taq DNA ligase (NEB, M0647S) were used according to the manufacturer’s protocol (including cycling parameters) for PCR extension and ligation of the plasmid with 2 sequential rounds of mutagenesis (2 bp changes each time). The PCR was DpnI treated (NEB, R0176L) for 1 hour at 37°C and transformed into XL10 Gold bacteria (Agilent, 200314). Colonies were expanded for minipreps (Qiagen, 27104) and Sanger sequenced (U6 primer) to confirm successful mutagenesis.
Pesch A.M., Hirsh N.H., Michmerhuizen A.R., Jungles K.M., Wilder-Romans K., Chandler B.C., Liu M., Lerner L.M., Nino C.A., Ward C., Cobain E.F., Lawrence T.S., Pierce L.J., Rae J.M, & Speers C.W. (2022). RB expression confers sensitivity to CDK4/6 inhibitor–mediated radiosensitization across breast cancer subtypes. JCI Insight, 7(3), e154402.
+ Open protocol
+ Expand
7

Colony PCR for Assembled Products

Check if the same lab product or an alternative is used in the 5 most similar protocols
To screen for positively assembled products, colonies from plates incubated overnight were randomly picked for colony PCR. After manually counting the number of colonies per plate, each colony was picked with a 200 µl pipette tip and directly added into the PCR mix described below. Using the same tip, the colony was inoculated into 500 µl LB medium for further growth. Primers (Table S2) corresponding to sequences ∼50 bp upstream of the first insert and 50 bp downstream from the last insert were used to amplify the size of the inserted sequence. Colony PCR results were analyzed by gel electrophoresis, and at least three positive colonies per plate were further grown overnight in 5 mL of LB medium + Ampicillin (100 µg/mL). Plasmid DNA was isolated by minipreps (Qiagen) according the manufacturer’s protocol, and the entire length of the insert region was sequenced (Elim Biopharmaceuticals). Detailed protocol in Table S3.
Roth T.L., Milenkovic L, & Scott M.P. (2014). A Rapid and Simple Method for DNA Engineering Using Cycled Ligation Assembly. PLoS ONE, 9(9), e107329.
+ Open protocol
+ Expand
8

Site-directed Mutagenesis of FabA

Check if the same lab product or an alternative is used in the 5 most similar protocols
The non-cleavable His6-tagged FabA template was generously provided by Dr. Hirotada at Keio University, Japan. The FabA gene was cloned into the pET28b expression vector and used as the DNA template for site-directed mutagenesis with the mutagenic primer listed in Table S2. Polymerase chain reactions (PCR) were performed using a combination of varying DMSO and magnesium concentration and “step down” annealing temperatures. FabA PCR products were digested with Dpn1 to eliminate template WT FabA. Digested PCR products were transformed into NovaBlue (EMD Millipore). Single colonies were isolated and their plasmids were extracted using Qiagen Minipreps. Site-directed mutagenesis was verified via DNA sequencing (IDT).
Finzel K., Nguyen C., Jackson D.R., Gupta A., Tsai S.C, & Burkart M.D. (2015). Probing the Substrate Specificity and Protein-Protein Interactions of the E. coli Fatty Acid Dehydratase, FabA. Chemistry & biology, 22(11), 1453-1460.
+ Open protocol
+ Expand
9

Lentiviral Transduction of Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral plasmids pLV-eGFP and pLV-mitoGFP were gifts from Pantelis Tsoulfas (Addgene plasmids # 36083 and 44385)84 (link), 85 (link). Lentiviral plasmids were isolated from Stbl3 cells by minipreps (Qiagen) of 5 mL overnight cultures established from single colonies. Lentivirus was produced in HEK293T cells. Transduction experiments were performed by spinoculation transduction method as described86 (link).
Do J.S., Zwick D., Kenyon J.D., Zhong F., Askew D., Huang A.Y., Van’t Hof W., Finney M, & Laughlin M.J. (2021). Mesenchymal stromal cell mitochondrial transfer to human induced T-regulatory cells mediates FOXP3 stability. Scientific Reports, 11, 10676.
+ Open protocol
+ Expand
10

Plasmid Cloning and Expression Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
All chemicals, reagents, buffers, and media were obtained from commercial vendors. POPC and POPS lipids were purchased from Avanti Polar Lipids. Gateway BP/LR cloning kits and DH5α subcloning efficiency cells were purchased from Invitrogen. Rosetta 2 (DE3) pLysS was purchased from EMD Millipore. DNA primers were purchased from Integrated DNA Technologies. PCR kits and minipreps were purchased from Qiagen. The initial EGFP-containing plasmid and the empty pDonr253, pDest527, and pDest566 vectors were obtained from the Protein Expression Laboratory of the Frederick National Laboratory for Cancer Research.
Miller S.E, & Schneider J.P. (2019). The effect of turn residues on the folding and cell-penetrating activity of β-hairpin peptides and applications toward protein delivery. Peptide science (Hoboken, N.J.), 112(1), e24125.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!