T3 rna polymerase

The full-length coding sequence of TCP24 was polymerase chain reaction (PCR) amplified and cloned into pBluescript SK. Digoxigenin-labeled sense and antisense probes were synthesized with T7 or T3 RNA polymerase (Roche). Inflorescences from wild type and transgenic plants were pretreated and hybridized as described previously (Liu et al., 2011 (link)). Locked nucleic acid (LNA)-modified probe of miR319a was synthesized and labeled with DIG at the 3′ end and used for in situ hybridization.

Probes for in situ hybridization were generated from robo2 cDNA obtained from Drosophila Genomics Resource Center (clone RE21729) and linearized with NotI. Digoxigenin-labeled anti-sense RNA probe was transcribed in vitro using T3 RNA polymerase according to the manufacturer's instructions (Roche). In situ hybridizations were performed as described [85] (link) and visualized with an Olympus BX51 microscope.

cDNA was amplified by reverse transcription-polymerase chain reaction out of total RNA isolated from wild-type 5 days post-fertilization embryos and was cloned into the pCR4-TOPO vector (Invitrogen). Primers for amplification were as follows: apoe forward 5′ TAGCGGCCGCGAATTCGCCC 3′, apoe reverse 5′ TAGTCCTGCAGGTTTAAACGA 3′; lepb forward 5′ TGCTTGTTAATATCATCCCTGGT 3′, lepb reverse 5′ GAGAATGAATGTCTCAGCCACA 3′; lepr forward 5′ CGCTGTAAAGACGTGAACGA 3′, lepr reverse 5′ TCTGCCTGAAGTCCATTCCT 3′; flk1 forward 5′ AAGTGGCTAAAGGCATGGAGTTC 3′, flk1 reverse 5′ GACACTCCATCTCCGAGTCAAGG 3′; vegfab forward 5′ CGCGTGCTCCAGTTATTTATTGTG 3′, vegfab reverse 5′ CACCTCCTTGGTTTGTCACATCTG 3′; vegfaa forward 5′ TGATACAGTTATTTCTCGCGGCTC 3′, vegfaa reverse 5′ TTTGCAGGAGCATTTACAGGTGAG 3′. Digoxigenin-labeled probes for in situ hybridization were synthesized using a DIG RNA labeling mix (Roche #11277073910) and T3 RNA polymerase (Roche #11031163001) and stored in 50% formamide at −20°C. Adult zebrafish tissues were dissected, fixed in 4% paraformaldehyde, and embedded in optimal cutting temperature medium. in situ hybridization on 12–16 μm cryosections of head and eye tissue was performed as described.^{41 (link)} Tissues were photographed on a Zeiss Axioskop II microscope using a Nikon Rebel camera.

ISH was performed as previously described (Lu et al., 2017). Digoxigenin‐labeled antisense and sense RNA were prepared from NotI‐linearized full‐length cby1‐pCS2+ using T3 RNA polymerase (Roche) and XhoI‐linearized full‐length cby1‐pCS2+ using SP6 RNA polymerase (Roche, Basel, Switzerland), respectively. Whole mount immunostaining was performed as previously described (Hoff et al., 2018).

The inner ears of P4 mice were used for cryosection with 12 μm thickness. Generation of the RNA probe and in situ hybridization (ISH) were performed as described previously (Grillet et al., 2009 (link)). The RNA probe complementary to part of mouse Kncn cDNA (NCBI: NM_001039124) was amplified using primers containing T7 and T3 promoter (Kncn-ISH-F/Kncn-ISH-R) for in vitro transcription using T7 RNA Polymerase (10881767001, Roche, Germany) and T3 RNA Polymerase (11031163001, Roche, Germany).

The in situ hybridization of zebrafish embryos using myoD, pax2, and krox20 riboprobes was performed using standard protocols^{51 (link)}. MyoD, pax2, and krox20 riboprobes were synthesized using T7, SP6, and T3 RNA polymerase (Roche, Indianapolis, IN, USA) respectively, from BamHI-, KpnI-, and PstI-digested cDNAs. For direct brightfield observations, zebrafish embryos were placed in methylcellulose on a depression slide, while for in situ hybridization staining, embryos were placed in 70% glycerol on a depression slide. Imaging of zebrafish embryos was performed with a Leica stereomicroscope. Statistical analyses of the phenotypic rescue experiments of zebrafish under different microinjection conditions were performed using a two-tailed Fisher Exact Test, where grade 1 to grade 4 embryos were combined together as being morphologically defective (morphant) embryos^{30 (link)}. The numbers of morphant versus normal embryos co-injected with tmem67 MO and mutant MKS3 mRNA were compared to the numbers of morphant versus normal embryos in clutches injected with MO alone using Fisher Exact Test, and similarly the numbers of morphant versus normal embryos co-injected with tmem67 MO and wild type ovine MKS3 mRNA were compared to morphant versus normal embryos in clutches injected with MO alone.