Target region amplicons were cloned into a TA-cloning vector (PCR Cloning Kit, E1202S, NEB) and transformed into E. coli DH5α competent cells as previously described22 (link). Briefly, 50 ng PCR product was added into 100 μl of ice-cold chemically competent DH5α cells. The cell mixtures were incubated on ice for 10 min, heat-shocked it at 42 °C for 30 s and returned it immediately to ice for 2 min, finally plated onto on LB plate containing 100 μg/ml ampicillin and incubated at 37 °C overnight. Plasmid DNA was isolated and sequenced by commercial sequencing company (Sangon Biotech).
Pcr cloning kit
Manufactured by New England Biolabs
Sourced in United States, France
The PCR Cloning Kit is a set of reagents and tools designed for the amplification and cloning of DNA fragments using the polymerase chain reaction (PCR) technique. The kit includes all the necessary components to perform PCR amplification and subsequent cloning into a vector.
Automatically generated - may contain errors
Lab products found in correlation
Quickextract, by Illumina (2 mentions)
Neon transfection system, by Thermo Fisher Scientific (2 mentions)
Methocult h4100, by STEMCELL (2 mentions)
Q5 hot start high fidelity dna polymerase, by New England Biolabs (2 mentions)
Revertra ace, by Toyobo (2 mentions)
T100 thermal cycler, by Bio-Rad (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Pminit, by New England Biolabs (1 mentions)
Epitect fast bisulfite conversion kit, by Qiagen (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Monarch genomic dna purification kit, by New England Biolabs (1 mentions)
Phusion hf polymerase, by New England Biolabs (1 mentions)
Phusion high fidelity pcr master mix with hf buffer, by New England Biolabs (1 mentions)
Pureyield plasmid miniprep system, by Promega (1 mentions)
Lambda exonuclease, by New England Biolabs (1 mentions)
Pgem 7zf vector, by Promega (1 mentions)
Rna clean and concentrator 25, by Zymo Research (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Xhoi, by New England Biolabs (1 mentions)
17 protocols using pcr cloning kit
1
TA-Cloning and Sequencing of PCR Products
2
Cloning PCR products into plasmid vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products for the Surveyor assay were cloned into plasmid vectors using the NEB PCR Cloning kit and transformed into DH5α-competent E. coli (NEB). 30 colonies were grown out in 5 mL liquid cultures overnight, and the plasmid DNA was isolated and characterized by Sanger sequencing.
3
Targeted Integration of Bxb1-LP Cassette into KCNH2 Locus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The vector to target the Bxb1-LP cassette to the KCNH2 locus (KCNH2-Bxb1-LP-TC) was generated by PCR-amplifying the Bxb1-LP cassette with primers containing 80 bp overhangs complementary to endogenous sequences ∼8.5 kb (5′) and ∼8.7 kb (3′) of KCNH2. The resulting PCR product was cloned into pMini T2.0 using the PCR Cloning Kit (NEB).
One copy of KCNH2 was deleted by electroporating Cas9 protein together with two gRNAs targeting both ends (gRNA for 5′ end: 5′-ATGAAGGCTTTCCCATCCGT-3′ and gRNA for 3′ end: 5′-ACTGTGCTGGGTACGCTGAC-3′) into LUMC0020iCTRL-06. This was confirmed for a hiPSC clone by PCR screening and Sanger sequencing, with ddPCR CNV assays verifying that the clone was monoallelic for KCNH2. Next, the KCNH2-Bxb1-LP-TC along with a Cas9-KCNH2 gRNA RNP complex (gRNA: 5′-CTGGTTGTGCTGACTGTGCT-3′) was electroporated into this modified hiPSC line. Following recovery and expansion of the electroporated cells, EGFP+ hiPSCs were clonally isolated. Targeted clones (KCNH2+/Acc) were further characterised by PCR screening and Sanger sequencing over the 5′ and -3′ homology arms. The resulting KCNH2+/Acc hiPSC line selected contained a single integration event of the Bxb1-LP cassette as determined by ddPCR.
One copy of KCNH2 was deleted by electroporating Cas9 protein together with two gRNAs targeting both ends (gRNA for 5′ end: 5′-ATGAAGGCTTTCCCATCCGT-3′ and gRNA for 3′ end: 5′-ACTGTGCTGGGTACGCTGAC-3′) into LUMC0020iCTRL-06. This was confirmed for a hiPSC clone by PCR screening and Sanger sequencing, with ddPCR CNV assays verifying that the clone was monoallelic for KCNH2. Next, the KCNH2-Bxb1-LP-TC along with a Cas9-KCNH2 gRNA RNP complex (gRNA: 5′-CTGGTTGTGCTGACTGTGCT-3′) was electroporated into this modified hiPSC line. Following recovery and expansion of the electroporated cells, EGFP+ hiPSCs were clonally isolated. Targeted clones (KCNH2+/Acc) were further characterised by PCR screening and Sanger sequencing over the 5′ and -3′ homology arms. The resulting KCNH2+/Acc hiPSC line selected contained a single integration event of the Bxb1-LP cassette as determined by ddPCR.
4
Genome-wide DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted and converted via bisulfite reaction following manufacturer's instructions (DNeasy Blood & Tissue kit, EpiTect Fast Bisulfite Conversion kit, Qiagen). Primers were designed to amplify CpG island regions adjacent or flanking the transcription start site (TSS) to gauge levels of promoter methylation. Regions were amplified from using 200 ng of bisulfite‐treated template and DNA polymerase (EpiMark Hot Start Taq Polymerase, NEB). Resultant PCR product was cloned into a sequencing plasmid following manufacturer's instruction (PCR Cloning Kit, NEB) and submitted for Sanger sequencing. A list of primers used is available in Supporting Information Table S5 .
5
Sex-linked Inheritance of UVRh1 in Heliconius
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine the sex-linkage of UVRh1 in 10 Heliconius species, genomic DNA was extracted from the dissected thorax of single adult male and female butterflies from each species using Monarch Genomic DNA Purification Kit (New England Biolabs) following the manufacturer’s protocol, except we added 10 µL proteinase K to each sample. To amplify UVRh1 genomic sequence, we used the primer pairs 5′ CGCTACAGTCTTGCAAGCTAC 3′ and 5′ ATATTTCTACAGTGGAATCGTAAAA 3′. For all amplifications using the UVRh1-specific primers, we used Phusion HF Polymerase (New England Biolabs) and annealing temperatures (Tm) of 60 °C and 58 °C, respectively. To rule out missing amplicons due to PCR failure in the fresh genomic DNA samples, we used the forward primer (ef44) 5′ GCYGARCGYGARCGTGGTATYAC 3′ and reverse primer (efrcM4) 5′ ACAGCVACKGTYTGYCTCATRTC 3′ to amplify the housekeeping gene EF1ɑ. The purified UVRh1 amplicons were cloned into the minT vector using the PCR cloning kit and following the manufacturer’s protocol (New England Biolabs (NEB)). The cloned amplicons were sequenced by Retrogen Inc. using the NEB-F, NEB-R primers supplied by the manufacturer.
6
Efficient dsDNA Template Synthesis and Purification
7
Molecular Phylogeny of Pelagophyte Algae
8
Characterizing Gene Knockout Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To ascertain the nature of mutations present in the knockout events, PCR primers (Target 1, located in Exon 1: Forward-ATGGCAAGCATCACAGCTTCAC, Reverse-CATTGTCCAGATAATCTAGTCCAGC; Target 2, located in Exon 7: Forward-TCACTCGATTGCACGTTACC, Reverse-GTAAAGGTTTTGCGTCCATGACC) were designed flanking each of the target sites. Amplicons were then cloned into pMiniTTM vector using a PCR Cloning kit (New England Biolabs, Ipswich, MA, USA) followed by its transformation into DH5α E. coli. At least twenty bacterial colonies for each target were used to extract DNA that were then sequenced via Sanger sequencing. These sequences were aligned to the original gene sequence that allowed us to determine the nature of mutations.
9
In Vitro Evaluation of Muc14a gRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Muc14a_3, Muc14a_4, Muc14a_5 and Muc14a_6 gRNAs were tested for in vitro activity using the Guide-it sgRNA In Vitro Transcription and Screening System (Takara Bio USA, Inc.). Each gRNA was transcribed and purified according to the In Vitro Transcription of sgRNA protocol. Two experiments were performed, allowing transcription to take place for 4 and 8 hours. Genomic DNA templates were obtained from Muc14a fragments previously cloned in a pMiniT 2.0 vector using PCR Cloning Kit (NEB) and primers kmer Muc14_F and 58537687_F. The genomic target was amplified by PCR with Cloning Analysis Forward and Reverse Primers, mapping in the pMiniT 2.0 plasmid. The amplicon corresponds to a genomic fragment of 1395 bp and sequencing confirmed the presence of target sites for all 4 gRNAs. For in-vitro digestions the DNA was excised from an agarose gel and purified with Monarch DNA Gel Extraction Kit (NEB). DNA concentration and absorbance ratio were measured with a NanoDrop Spectrophotometer (ThermoScientific). PCR amplification of target DNA and a Cas9 cleavage assay were then carried out according to the protocol.
10
Generation of NSD2 Targeted Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A double-stranded DNA fragment (IDT gBlock) was used to generate a customized sgRNA expression construct composed of a U6 promoter, sequence targeting the K1099 allele of NSD2 (TGGGGAGCTGATCGACAAGG), and an sgRNA scaffold described previously (63 (link)). This construct was PCR-amplified, column-purified (Qiagen), and transfected with Cas9-GFP (Addgene #42234, (64 (link))) using the Neon Transfection System (Life Technologies). GFP-positive cells were sorted (BD FACSAria) 20 hours post-transfection, plated in methylcellulose (MethoCult H4100, Stem Cell Technologies), and single-cell derived colonies isolated. DNA extracted from colonies (QuickExtract, Epicentre) was amplified and sequenced to detect CRISPR-editing events. PCR products were cloned and sequenced to assess mutant allele frequency (PCR Cloning Kit, NEB).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!