Total RNA was extracted using TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The RNA samples were stored at −80°C until use. The extracted RNA was reverse-transcribed into cDNA using the First-Strand cDNA Synthesis kit (Qiagen, Inc.) according to the manufacturer's protocols. Each cDNA sample was added to a 20 µl reaction volume containing an appropriate primer set and SYBR green supermix. Triplicates of all samples were analyzed. The SYBR Real-Time PCR kit (Qiagen, Inc.) was used under the following conditions according to the manufacturer's protocols: 95°C for 2 min, followed by 40 cycles of 95°C for 5 sec and 60°C for 10 sec. Relative expression was normalized to GAPDH and calculated according to the 2−∆∆Cq method (19 (link)). In the present study, the following primers were used: GAPDH forward primer GCCACATCGCTCAGACACCAT, GAPDH reverse primer: CCCATACGACTGCAAAGACCC, Human FSCN1 forward: GACGAGCTCTTTGCTCTGGA, Human FSCN1 reverse: TCGGTCTCCTCGTCCTGATT, Human FSCN2 forward: TGGAGGAGAGTCACCCACAG, Human FSCN2 reverse: TCAGGAAGGTCTCGTGGTCT, Human FSCN3 forward: GCTTCGTTCAGCCAATGGCTAC, Human FSCN3 reverse: ATCCTGCCACAGTTCCAGTGCA. The QuantiTect SYBR Green PCR kit (Qiagen, Inc.) was used to perform real-time quantitative PCR. GAPDH was used as an internal control. Experiments were replicated three times.
Sybr real time pcr kit
Manufactured by Qiagen
Sourced in United States
The SYBR Real-Time PCR kit is a laboratory equipment product from Qiagen. The kit is designed for the detection and quantification of DNA sequences using real-time PCR technology. It employs the SYBR Green I dye to monitor the amplification of target DNA sequences in real-time.
Automatically generated - may contain errors
Lab products found in correlation
First strand cdna synthesis kit, by Qiagen (5 mentions)
Lightcycler 480, by Roche (2 mentions)
Trizol reagent, by CWBIO (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Qiagen (1 mentions)
9 protocols using sybr real time pcr kit
1
Quantification of Fascin Family Genes
2
Quantitative Analysis of EYA Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total RNA, produced complementary DNA (cDNA), and performed a polymerase chain reaction. Details of the procedure and primer sequences were as follows:
Human EYA1 forward primer: TGTTGGAGGTCTGCTTGGTC, Human EYA1 reverse primer: TGAGCGAGAGTGCTTTCAGG;
Human EYA2 forward primer: GTGGTGATCGGTGATGGTGT, Human EYA2 reverse primer: GAGATGCTGCTGATCCTGCT;
Human EYA3 forward primer: CAGCAGTAGCCAGCATCTCA, Human EYA3 reverse primer: GGTGCTCTCTGCATCACTGT;
Human EYA4 forward primer: AGCGTGTGTTTGTCTGGGAT, Human EYA4 reverse primer: TCTTCCATGCGGAGTCCAAG;
Human GAPDH forward primer GCCACATCGCTCAGACACCAT, Human GAPDH reverse primer: CCCATACGACTGCAAAGACCC.
3
Quantifying crh-1 Isoform Expression
4
Gene Expression Analysis via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and reverse transcribed into cDNA using the RNeasy Mini kit (Qiagen, USA) and the First-Strand cDNA Synthesis kit (Qiagen, USA) according to the manufacturer’s instructions. RT-qPCR was performed using a SYBR Real-Time PCR kit (Qiagen, USA) under the following conditions: 95°C for 2 min, followed by 40 cycles of 95°C for 5 s and 60°C for 10 s. Relative fold expression was calculated using the 2−ΔΔCt method. Each analysis was performed in triplicate. In addition, β-actin was used as an internal reference gene. The primers used in the study are listed in Table 1
5
Quantifying OVOL Gene Expression in ccRCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ccRCC tissues and adjacent non-tumorous tissues, as well as from ccRCC cell lines, using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The extracted RNA was reverse-transcribed to cDNA using the First-Strand cDNA synthesis kit (Qiagen GmbH) according to the manufacturer's protocol. qPCR was performed using the SYBR Real-Time PCR kit (Qiagen GmbH). The PCR thermocycling conditions were as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 5 sec and 60°C for 10 sec. The relative gene expression levels were calculated using the 2−ΔΔCq method (24 (link)). Each analysis was performed in triplicate. ACTB served as an internal reference gene. The sequences of the primers used for qPCR were: GAPDH forward, 5′-GCCACATCGCTCAGACACCAT-3′ and reverse, 5′-CCCATACGACTGCAAAGACCC-3′; human OVOL1 forward, 5′-AGACACGTCCGAACTCACAC-3′ and reverse, 5′-TGCTGCACACCATGGATCTT-3′; human OVOL2 forward, 5′-CAACGACACCTTCGACCTGA-3′ and reverse, 5′-TCAGGTGGGACTCCAGAGAG-3′; human OVOL3 forward, 5′-TTCGATCTCAAGCGCCACAT-3′ and reverse, 5′-GCTGTCCATGCACCTTAGCA-3′.
6
Quantification of SLFN11 in Renal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was first extracted from renal cancer cell lines (ACHN, 786-O, OSRC-2, and Caki-1) and normal renal tubular epithelial cells (HK-2) using TRIzol reagent (Cwbio, China), and then the RNA was reverse transcribed using the First-Strand cDNA Synthesis Kit (Qiagen, USA). qPCR was performed using the SYBR Real-Time PCR kit (Qiagen, USA), and a relative quantitative data analysis was performed with the 2−ΔΔCt method. The primer sequences for SLFN11 were 5′-TCGAAGGCTCAGGTGATT-3 (forward) and 5′-TGGGTAAGATGGTTCCACA-3′ (reverse), and the reference gene was β-actin.
7
Molecular Profiling of Kidney Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty paired KIRC (kidney renal clear cell carcinoma) and adjacent normal tissues were pathologically confirmed by two independent pathologists and subsequently included in this study. Twenty pairs of matched ccRCC tissues and adjacent normal kidney tissues were immediately frozen after resection and stored in liquid nitrogen until use in the First Affiliated Hospital of Nanchang University from 2019 to 2020. The extracted RNA was reversely transcribed into cDNA with the First-Strand cDNA Synthesis kit (Qiagen, USA) in accordance with the manufacturer’s instructions. SYBR Real-Time PCR kit (Qiagen, USA) was employed to perform RT-qPCR under the specific conditions: 95°C for 2 min, followed by 40 cycles of 95°C for 5 s and 60°C for 10 s. The 2 −ΔΔCt method was utilized to evaluate the relative gene expressions. Each analysis was performed in triplicate. In addition, β-actin was considered as an internal reference gene.
8
Quantifying Isoform-Specific CRH-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol from WT animals grown to the young adult stage. Fifty nanograms of total RNA was used for cDNA synthesis. qPCR was performed using a Qiagen SYBR real time PCR kit. Isoform-specific primers were used for amplification of the different crh-1 isoforms. The primers used are listed in in Table 1 . qPCR was done using the Roche Light Cycler 480. Ct values were calculated using Equation 2 with the Roche software. The data were analyzed using ΔC method (Eq. 3 ).
GOI indicates gene of interest, and HG indicates the housekeeping gene, act-1.
GOI indicates gene of interest, and HG indicates the housekeeping gene, act-1.
9
GRAMD1A Expression in Renal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Cwbio, China) from cell lines (HK-2, A498, 769-P, 786-O, Caki-1, and OSRC-2) and paired tissues from 19 pairs of KIRC patients from our centre, followed by the cDNA synthesis kit (Qiagen, USA) and SYBR real-time PCR kit (Qiagen, USA) for reverse transcription and qPCR, respectively; the 2-ΔΔCt method was used for relative quantification. The primer sequences are as follows: GRAMD1A forward: GATGCTCTCTTCTCGGACTCG, reverse: GATGGGGATGGTGTACGTC; β-actin forward: TCTCCCAAGTCCACACAGG, reverse: GGCACGAAGGCTCATCA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!