Pgex 4t 3

The RNF114 clone was obtained from the Center for Human Growth and Development of UTSW. The RNF114 cDNA was subcloned into the pcDNA3 (Addgene), pCDNA5-ZZ-TEV-Flag vector (Addgene), or pGEX-4T-3 (Addgene) vectors for transient transfections. Besides, the RNF114 cDNA was transferred into the plenti-6.3-V5-Dest vector (Thermo Fisher Scientific) for the subsequent construction of stable cell lines. Various site mutations of RNF114 were introduced using standard site-directed mutagenesis techniques. RNF114 CRISPR KO constructs were made according to a previously described protocol (74 (link)). Basically, three top ranked single guide RNAs were chosen (RNF114 sg1F: CACCGGTGTACGAGAAGCCGGTAC; RNF114 sg1R: AAACGTACCGGCTTCTCGTACACC; RNF114 sg2F: CACCGGACACGTGAAGCGTCCTAG; RNF114 sg2R: AAACCTAGGACGCTTCACGTGTCC; RNF114 sg3F: CACCGCACGTGTCCCGTGTGCTTAG; RNF114 sg3R: AAACCTAAGCACACGGGACACGTGC), and they were subcloned into LentiCRISPR v2 vector (Addgene). All the mutant constructs were confirmed by DNA sequencing analysis. PARP1–green fluorescent protein (GFP) and XRCC1-GFP plasmids were gifts from X. Yu (City of Hope).

All plasmids were transfected with Lipofectamine 2000 (Life Technologies-Invitrogen, USA) according to the manufacturer’s instructions. H1.2, H1.3 and H1.4 cDNAs were amplified and cloned into the p3× FLAG-CMV-10 vector (Addgene, USA). Full-length H1.2 and various fragments (N-terminal domain, 1–35 aa; globular domain, 36–112 aa; C-terminal domain, 113–213 aa; ΔC1, 1–179 aa; ΔC2, 1–112+180–213 aa; ΔC, 1–112 aa) were cloned into the pEGFP-C2, pGEX-4T3 or pET28a vectors (Addgene, USA). The full-length FLAG-ATM expression construct was purchased from Addgene, USA. GST-ATM fragments (F1, 1–247 aa; F2, 250–522 aa; F3, 523–769 aa; F4, 722–1102 aa; F5, 1098–1371 aa; F6, 1245–1435 aa; F7, 1239–1770 aa; F8, 1764–2138 aa; F9, 2141–2428 aa; F10, 2427–2841 aa; F11, 2842–3056 aa; F12, 2682–3012 aa) were provided by Dr. Fabrizio d’Adda di Fagagna (FIRC Institute of Molecular Oncology Foundation, Italy). Site-specific mutations of H1.2 (T126/146/165A, T126/146/165E, E115A, S173A, S188A) were generated using a site-directed mutagenesis kit (Vazyme, China).