Total RNAs were isolated from the cells using TRIzol reagent (TaKaRa, Kusatsu, Japan). The RNA was subsequently treated with RNase‐free DNase I (Roche, Germany, Switzerland). Synthesis of the complementary DNA was done by using the BcaBest RNA PCR kit from Takara according to the manufacturer's instructions. Quantitative real time polymerase chain reaction (qRT‐PCR) was carried out using the iQ5 Multicolor Real‐Time PCR Detection System (Bio‐Rad Laboratories, Hercules, California) with Real‐Time PCR Master Mix (TaKaRa). The sequences of primers used in this study were the following: hsa‐circ‐0076248, forward 5′‐CCTCGATAACCACGCCAACT‐3′, reverse 5′‐TGGAGCGGAATCATCGTCTG‐3′; miR‐181a reverse transcript primer (stem‐loop method): 5′‐GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACTCAC‐3′; forward primer, 5′‐GCAACAUUCAACGCUGUCG‐3′, reverse primer, 5′‐GTGCAGGGTCCGAGGT‐3′; SIRT1, forward, 5′‐ATCTGACTTTGCTCCCCTTAACC‐3′, reverse, 5′‐GGGCCCTGGTTGCAAGA‐3′. Dihydronicotinamide‐adenine dinucleotide phosphate (NAPDH), forward, 5′‐CAATGACCCCTTCATTGACC‐3′, reverse, 5′‐GACAAGCTTCCCGTTCTCAG‐3. Expression of each gene was quantified by measuring Ct values and normalized using the 2 − Δ Δ C t
Bcabest rna pcr kit
Manufactured by Takara Bio
Sourced in Japan
The BcaBest RNA PCR kit is a reagent kit designed for the amplification and detection of RNA using reverse transcription-polymerase chain reaction (RT-PCR) technology. The kit includes all necessary components for efficient RNA extraction, reverse transcription, and real-time PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Iq5 multicolor real time pcr detection system, by Bio-Rad (5 mentions)
Rnase free dnase 1, by Roche (4 mentions)
Real time pcr master mix, by Bio-Rad (3 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Real time pcr master mix, by Takara Bio (1 mentions)
Peltier thermal cycler, by Bio-Rad (1 mentions)
Realtime pcr master mix, by Toyobo (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
3 full race core set ver 2.0 kit, by Takara Bio (1 mentions)
Real time pcr master mix sybr green, by Toyobo (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
T100 real time pcr system, by Bio-Rad (1 mentions)
Abi 7900 fast system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
11 protocols using bcabest rna pcr kit
1
Quantitative Analysis of Circular RNA and miRNA
2
RNA Isolation and Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen) and reverse-transcribed into cDNA using BcaBest RNA PCR kit from TaKaRa according to the manufacturer’s instructions. Quantitative real-time PCR was performed using a Peltier Thermal Cycler (BioRad) plus Realtime PCR Master Mix (SYBR Green, Toyobo, Osaka, Japan). The specific primers used for PCR are listed in Supplementary Table S1 . GAPDH was chosen as the endogenous control in the assay.
3
miRNA Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent. The RNA was subsequently treated with RNase-free DNase I. The cDNA was synthesized with BcaBEST RNA PCR kit from TaKaRa according to the manufacturer’s instructions. For detection of miR-503 expression, stem-loop RT-PCR was performed. Quantitative real-time PCR was performed by using SYBR green reagent with ABI Prism 7500 Fast detection system. Relative expression was normalized to the expression of U48 small RNA or GAPDH and measured by a comparative CT method.
4
Isolation and Characterization of TsGPX Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We searched the T. salsuginea ESTs in the GenBank using the CDs of GPX1-8 from A. thaliana. The ESTs representing TsGPX genes were assembled using software DNASTAR (DNASTAR Inc., Madison, WI, USA). The primers used for isolating full length CDs of TsGPX gene were designed using Primer3 (http://primer3.ut.ee/ ). Total RNA from T. salsuginea seedlings was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The potential contaminating genomic DNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI, USA). The cDNA was synthesized using BcaBEST RNA PCR Kit (Takara, Shiga, Japan) according to the manufacturer’s protocol. 3′ RACE were performed to isolate full length CDs of some members of TsGPX gene family using 3′ Full RACE Core Set Ver.2.0 kit (TaKaRa, Shiga, Japan). All primers are listed in Tables S2 and S3 .
5
Quantifying VAV3 mRNA in Glioblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA expression of VAV3 in human glioblastoma samples was analyzed by the online database GlioVis (gliovis.bioinfo.cnio.es/). Total RNA from cells was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The total RNA was subsequently treated with RNase-free DNase I (Roche Diagnostics). Complementary DNA synthesis was performed using a BcaBest RNA PCR kit from Takara Bio, Inc. according to the manufacturer's protocols. qPCR was performed using an iQ™5 Multicolor Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.) with Realtime PCR Master Mix (SYBR Green, Toyobo Life Science). The thermocycling conditions used for qPCR were as follows: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec, in a total volume of 20 µl. Relative mRNA expression levels were assessed using the 2−ΔΔCq method (20 (link)). GAPDH was used as the endogenous control. The PCR primer sequences used were as follows: VAV3 forward (F): 5′-CTGCCAGCTGCTTAACAACC-3′ and reverse (R), 5′-CAGGCCGTGAGAAATGTCCT-3′; miR-218 RT primer, 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATGG-3′ (21 (link)); miR-218 qPCR F primer, 5′-GTGCAGGGTCCGAGGTATTC-3′, miR-218 qPCR R primer, 5′-TTGATCTAACCATGTGTCGTA-3′; and GAPDH F, 5′-GAAGGTGAAGGTCGGAGTC-3′ and R, 5′-GAAGATGGTGATGGGATTTC-3′.
6
Quantifying miR-623 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was acquired with miRNA extraction kit GenePharma (Shanghai, China). The purity and the amount of isolated RNA were determined with NanoDrop Spectrophotometer (Thermo Scientific, USA). Two μg total RNA was reversely transcribed into cDNA using BcaBest RNA PCR Kit (TaKaRa, Japan). Quantitative RT-PCR (qRT-PCR) was performed to determine gene expression using SYBR Green dye (Kangwei, China) on a BIO-RAD T100 real-time PCR system (BIO-RAD, USA). U6 miRNA and ACTIN were included as internal controls of miR-623 mRNA. The results were interpreted using the 2^-DDCt method.
7
Glioma Cell Total RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from glioma cells was isolated using TRIzol reagent (Invitrogen, USA). The RNA was subsequently treated with RNase-free DNase I (Roche, Switzerland). Synthesis of cDNA was done by using the BcaBest RNA PCR kit from TaKaRa (Japan) according to the manufacturer’s instructions. Quantitative RT-PCR was carried out using the iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad) with Realtime PCR Master Mix (SYBR Green). The PCR primers are listed in Supplementary Table 1 , β-actin was selected as the endogenous control in the assay.
8
Quantitative Analysis of miR-613 and SOX9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the frozen tissue samples and the cultured cells using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. Then, cDNA was synthesized from 100 ng of the RNA, using a BcaBEST RNA PCR kit (Takara, Dalian, People’s Republic of China) according to the manufacturer’s instruction. The cDNAs were subjected to the quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Premix Ex Taq (Takara) to detect miR-613 and SOX9 mRNA with the ABI 7900 Fast system (Thermo Fisher Scientific). The primers used in this study have been described previously.15 (link),22 (link) The U6 gene was used as an endogenous control for miRNA expression,25 (link) whereas the GAPDH gene was used as an endogenous control for mRNA expression. The relative expression levels of miR-613 and SOX9 mRNA were calculated using the comparative delta CT (2−ΔΔCT) method.26 (link)
9
Cloning and tagging of human CD93
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length cDNA of human CD93 (GenBank™ accession number NM_012072.3) was amplified using the BcaBEST™ RNA PCR kit (Takara Bio Inc., Otsu, Japan) from reverse transcription of total RNA extracted from HUVEC (oligonucleotides CD93F, 5'-GAGAGGATCCGCCGCCACCGGGATGGC CACCT-3' and CD93R, 5'-GAGAGAGCGGCCGCCTCTAG GGCCACCTCAC-3'. The PCR fragments were cloned in pcDNA3 cloning vector (Invitrogen). CD93 full-length cDNA was subcloned into pEYFP-N1 vector (Clontech Lab), positioning the fluorescence tag at C-terminal. To generate the chimeric constructs containing the extracellular domains of CD93 fused to Myc tag, DNA fragments were PCR-amplified from a cDNA clone corresponding to the complete sequence of the human CD93 gene and cloned in pCS2+myc tag vector [37 (link)]. The chimeric constructs and the primers used for DNA amplification are reported in Table II . All constructs were confirmed by sequencing.
10
Quantification of miR-101 in Glioma and TBI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression level of miR-101 in glioma cells, glioma tissues and traumatic brain injuries tissues was measured by real-time quantitative RT-PCR (qRT-PCR). Total RNA was isolated from frozen samples and cells using Trizol reagent (Invitrogen, CA, USA) under the guidance of manufacturer's protocol. RNA was treated with RNase-free DNase I (Roche, Switzerland). Then, BcaBest RNA PCR kit (TaKaRa, Dalian, China) was used to synthesize the cDNA according to the manufacturer's protocol. All primers were synthesized by Shanghai Sangon Technology co., LTD. Quantitative RT-PCR was carried out by the iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad) with Real-time PCR Master Mix (SYBR Green).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!