Abi prism 7900 ht fast real time instrument

In order to select the SNPs, we previously retrieved genotypic data of the Han Chinese population from the HapMap database (http://hapmap.ncbi.nlm.nih.gov/). The gene region and potential regulatory sequences were considered during the selection of tagSNPs. Under the following criteria: minor allele frequency (MAF) ≥ 0.2 and r² ≥ 0.8. We selected three tagSNPs (rs10203363, rs13411714, and rs3820926) and one functional variant (rs1522813) in the upstream of the gene. Genotyping of each gene was performed by using an optical 384-well plate with the TaqMan probe technique and the ABI PRISM 7900 HT Fast Real-Time instrument (Applied Biosystems, Foster City, CA, USA).

Weighted brains were stored in trizol reagent and homogenized at 4°C, the RNA was extracted by Chomczynski protocol and quantified and assessed for purity by nanodrop. qRT-PCR was performed to quantify the SARS-COV2 viral load present in the tissue. SARS-CoV-2 RNA relative amounts detected for each experimental condition as a cycle threshold (Ct) value were compared, with a mean Ct value determined for the positive infection control. The purified RNA was then used to perform the synthesis of first-strand complementary DNA, using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara) for RT-PCR. Real-time PCR, using the SYBR green dye–based PCR amplification and detection method, was performed to detect the complementary DNA. We used the forward primer SF(CTCATCACGTAGTCGCAACAGTTC) the reverse primer SR (CAAGCTGGTTCAATCCTGTCAAGCA) for S protein and the forward primer AF (CTCCATCCTGGCCTCACTGT) and the reverse primer AR (GAGGGGCCGGACTCATCGT) for actin. The PCR conditions were as follows: 42°C for 2 min, 45 cycles of 95°C for 10 s, annealing at 95°C for 5 s, and elongation at 62°C for 30 s, followed by a final elongation at 72°C for 10 min. RT-PCR was performed using the ABI-PRISM 7900HT Fast Real-Time instrument (Applied Biosystems) and optical-grade 96-well plates. Samples were run in duplicate, with a total volume of 20 µL.