The soil sample was collected from the waste site Jhiri, Ranchi (23.40° N, 85.25° E) in June 2022 and immediately brought to the laboratory in ziplock bags. Two grams of soil was suspended in 18 mL of 0.9% NaCl (w/v) in a 150 mL Erlenmeyer flask and suspension was incubated at 28°C for 2 h on a rotary shaker at 180 rpm. Serial dilution of the suspension was prepared and plated on the LB-agar (Himedia, India) plate supplemented with different concentrations (1 to 5 mM) of heavy metal such as zinc sulfate (ZnSO4), copper sulfate (CuSO4), cadmium chloride (CdCl2), mercuric chloride (HgCl2) and nickel sulfate hexahydrate (NiSO4.6H2O), and incubated at 37°C for 24 to 48 h. One colony showing the optimum growth on the ZnSO4-amended (up to 5 mM) LB-agar plate was labeled as OS-1 and was used for further detailed characterization. To determine the growth pattern of the test isolate, one loop of a single colony was inoculated in 100 mL of LB-broth medium supplemented with ZnSO4 (1 to 5 mM), as well as other tested heavy metals, and grown in a shaker incubator at 37°C with 180 rpm for 24 h. The growth pattern was determined by using a spectrophotometer (HACH, United States) after a four-hour interval by measuring optical density (OD) at OD590. The strain was maintained in 20% glycerol in a − 80°C freezer (Thermo Fisher Scientific, United States).
Lb agar
Manufactured by HiMedia
Sourced in India
LB agar is a solid growth medium used for culturing bacteria. It provides essential nutrients and agar to support the growth of a wide range of bacterial species.
Automatically generated - may contain errors
Lab products found in correlation
Lb broth, by HiMedia (9 mentions)
Luria bertani broth, by HiMedia (3 mentions)
Sodium chloride (nacl), by Merck Group (3 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by HiMedia (2 mentions)
Hepes, by MP Biomedicals (2 mentions)
Potassium chloride (kcl), by MP Biomedicals (2 mentions)
Agar, by HiMedia (1 mentions)
Sodium hydrogen phosphate, by Merck Group (1 mentions)
Staphylococcus aureus, by American Type Culture Collection (1 mentions)
Amphotericin b, by Lonza (1 mentions)
Calcium chloride, by Merck Group (1 mentions)
Trypsin, by Lonza (1 mentions)
Fetal bovine serum (fbs), by Lonza (1 mentions)
Dulbecco s modified eagle medium, by Lonza (1 mentions)
Nutrient broth medium, by HiMedia (1 mentions)
Casein, by HiMedia (1 mentions)
Plasmid extraction kit, by Qiagen (1 mentions)
Dpni, by Thermo Fisher Scientific (1 mentions)
Dntps, by Thermo Fisher Scientific (1 mentions)
Pcr buffer, by Merck Group (1 mentions)
25 protocols using lb agar
1
Isolation and Characterization of Heavy Metal-Tolerant Bacteria
2
Bacterial Cell Imaging via Electron Microscopy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For electron microscopy, we used a JEM-1200EX electron microscope (JEOL). Bacterial cells were grown on both LB agar (HiMedia, Mumbai, India) and LB agar supplemented with 10% sucrose for 48 h at 28 °C and were then suspended in saline water (0.85% NaCl). Samples were fixed to a carbon-coated grid and stained with 2% uranyl acetate; they were then photographed using the JEOL microscope mentioned above.
3
Salmonella enterica Typhimurium Strain Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type (WT) bacteria, Salmonella enterica serovar Typhimurium strain 14028S used in this study was a generous gift from Professor Michael Hensel, Department of Microbiology, University of Osnabruck, Germany. All the bacterial strains used in this study were revived from glycerol stock (stored in -80 0 C) and plated either only on LB agar (purchased from HiMedia) (for the wild-type Salmonella) or LB agar along with appropriate antibiotics likekanamycin (50 μg/mLfor the ompA knockout strains), chloramphenicol (25 μg/mLfor the ompC, ompD, and ompF knockout strains), and ampicillin (50 μg/mLfor the complemented and the OmpA loop mutant strain). The complete list of bacterial strains used in this study has been listed below. (Description in Table 1). For all the experiments, a single bacterial colony from the LB agar plates (with or without antibiotics) was inoculated into the LB broth, followed by overnight incubation. The overnight-grown stationary phase culture was further subcultured at a 1: 100 ratio in a fresh LB tube and allowed to grow for 6 hours so that the bacteria attain the log phase. The OD of the bacterial cells was normalized to 0.1, which corresponds to 10 6 CFU of bacteria. This normalized culture was used for all the experiments mentioned below.
4
Isolation and Characterization of Oil-Degrading Bacillus subtilis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study bacterium B. subtilis A1 was used, which was isolated and identified from an Indian crude oil reservoir also crude oil used in this study was collected from same oil reservoir, the sampling site was presented in Figure 1 (latitude: 10.6694 and longitude: 79.3155). This strain was identified by 16S rDNA sequencing and deposited under NCBI Genbank accession number KP895564. The strain was retrieved and sub-cultured in Luria–Bertani (LB) agar plates [g/l 10.0 tryptone, 5.0 yeast extract, 10.0 sodium chloride with 15.0 agar (Himedia, Mumbai, India)] and incubated at 37°C for 24 h. Further optimized conditions were applied to culture preparations by single colony inoculation method using LB broth (pH: 7.0) and incubated in an orbital shaker (150 rpm) for 24 h at 37°C.
5
Chitosan-Based Antimicrobial Formulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chitosan (DDA-89.4%) was bought from the Japanese company Koyo Chemicals Co., Ltd., Japan. Fischer Scientific, USA provided the NaOH and acetic acid. PHMB was acquired from Simson Pharma Limited, Mumbai, India. The Microbiology Laboratory at Amrita Hospital in Kochi, India, provided the ATCC isolates of bacterial strains like Escherichia coli (ATCC 25922), Klebsiella pneumoniae (ATCC 700603), Pseudomonas aeruginosa (ATCC 9027), Methicillin-Resistant Staphylococcus aureus (MRSA) (ATCC 43300) and Staphylococcus aureus (ATCC 25923). LB Agar and LB Broth were acquired from HiMedia, India. Gibco provided Dulbecco’s modified Eagle medium, Fetal Bovine Serum, Trypsin, Amphotericin B, and Tryphan Blue, which were obtained from Lonza. Sigma provided the resazurin powder. We bought calcium chloride, sodium chloride, and sodium hydrogen phosphate from Merck, USA.
6
Antibacterial Activity of Green Synthesized Silver NPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacteria such as, Shigella sonnei, Pseudomonas aeruginosa, Staphylococcus aureus, Bacillus subtilis and Shigella dysentriae were used as the test organisms. All these isolates were obtained from Microbial Type Culture Collection, Pune, India. All organisms were sub cultured using LB Agar (Himedia, Mumbai, India). Then, the organisms were cultured individually in 100 ml Erlenmeyer flask containing nutrient broth medium (Himedia, Mumbai, India) and was grown in an rotary shaker incubator at 37 °C. The culture was centrifuged and the pellet was harvested, then it was washed twice in water, followed by Phosphate Buffered Saline (PBS) and the broth was diluted appropriately (106 CFU/ml). Antibacterial activity test was performed to analyze the biological activity of green synthesized silver NPs against these tested bacterial strains as suggested by Cheesbrough (2000) . For the determination of antibacterial activities of the green synthesized NPs, 20 µg of sample was loaded into the wells and the plate was kept in refrigerator for about 2 h for sample diffusion. Then all plates were incubated in an incubator at 37 °C for overnight and antibacterial activity was recorded. The zone of inhibition was tabulated.
7
Bacterial Growth Protocol Using LB Broth and Agar
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Media required for bacterial growth, Luria-Bertani (LB) broth and LB agar as well as Casein were procured from HiMedia. All the rest of the reagents and chemicals were brought from SRL.
8
Detailed Biochemical Protocols for Cellular Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PCR-based work, materials like PCR buffer and Taq polymerase were purchased from Sigma Aldrich, USA, and dNTPs were from Fermentas, USA. For expression studies, materials like cDNA synthesis kit, SYBR green, and ROX solution were purchased from Fermentas, USA. RNA later was purchased from Sigma Aldrich, USA. For cell culture studies, DMEM, FBS, and metformin were purchased from Sigma Aldrich, USA. LB agar and LB broth were purchased from Himedia; DPnI from Thermo scientific; A769962 from Abcam; Q5 polymerase from New England Biolabs and Plasmid extraction kit from Qiagen. For western blot analysis, phospho-AMPK rabbit monoclonal antibody, total AMPK rabbit monoclonal antibody, and beta-actin rabbit monoclonal antibody were purchased from CST, USA. The anti-rabbit IR DYE 800 antibody was purchased from Li-COR Biosciences, USA.
9
Rapid Pathogen Detection with Aptamer Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Luria–Bertani (LB) broth, LB agar, Baird–Parker agar base, and egg yolk (EY) tellurite enrichment, Tryptic Soy Broth (TSB) and Brain heart infusion (BHI) broth were obtain from Himedia (India). Potassium phosphate dibasic, citrate protected gold nano particle (20 nm), glycine, sodium chloride (NaCl), sodium hydroxide, o-Phenylenediamine dihydrochloride (OPD), Dulbecco's phosphate buffer saline (DPBS), bovine serum albumin (BSA), and all PCR reagents obtained from Sigma-Aldrich (India).
Synthesized single-stranded DNA (ssDNA) aptamer (SEB2) 5′TAGCTCACTCATTAGGCACGGGTAGGCCATAATATCTTATTAGCGTAATTCTGCGATTGGCATAGTTAAGCCAGCC3′ (Mondal et al., 2015 (link)) and random ssDNA (RDNA) 5′CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT3′ were obtained from Xcelris Bioscience (Ahmadabad). DNA stock solution was prepared in 10 mM DPBS (pH 7.0) and was stored at 4°C before use. All other reagents were of analytical reagent grade and ultra-pure water (Milli-Q plus, Millipore Inc) used throughout the experiments.
Synthesized single-stranded DNA (ssDNA) aptamer (SEB2) 5′TAGCTCACTCATTAGGCACGGGTAGGCCATAATATCTTATTAGCGTAATTCTGCGATTGGCATAGTTAAGCCAGCC3′ (Mondal et al., 2015 (link)) and random ssDNA (RDNA) 5′CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT3′ were obtained from Xcelris Bioscience (Ahmadabad). DNA stock solution was prepared in 10 mM DPBS (pH 7.0) and was stored at 4°C before use. All other reagents were of analytical reagent grade and ultra-pure water (Milli-Q plus, Millipore Inc) used throughout the experiments.
10
Purification of Recombinant Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sodium chloride, trizma, glycine, SDS, EDTA, ANS, Gdm-HCl, PMSF, and imidazole were obtained from Sigma Chemical Co. Nickel–nitrilotriacetate (Ni–NTA) agarose–based resin was brought from Qiagen. Mono-Q ion-exchange and superdex-75 (10/300 GL) gel filtration columns were purchased from GE Healthcare. LB agar, LB broth, glycerol, ammonium persulphate, IPTG, and kanamycin were purchased from Himedia Laboratories. Syringe filters (0.22 and 0.02 μm cutoff) were purchased from Millipore Corporation. All chemicals and reagents used were of analytical grade.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!