To generate PB-TRE3G-OKS and PB-TRE3G-c-Myc, pTRE3G-IRES (Clontech) was amplified by PCR and cloned into PB-hCMV*1-cHApA [27] (link), [28] (link) to yield PB-TRE3G-cHApA, and then inserts from PB-TET-OKS [8] (link), [29] (link) and PB-TET-c-Myc were introduced into PB-TRE3G-cHApA. To generate PB-(CAG-Tet3G; EOS-C(3+)-EGFP-IRES-puro), inserts from pCMV-Tet3G (Clontech) and PB-EOS-C(3+)-EiP [8] (link), [9] (link) were cloned into PB-CAG-rtTA_Adv [8] (link), [29] (link). To generate PB-(CAG-TagRFP-IRES-hyg; Acr-EGFP), inserts from pAcr3-EGFP [11] (link) was introduced into empty PB vector, and the resultant vector (PB-Acr-EGFP) was amplified by PCR and introduced into PB-CAG-cHA-IRES-hyg to yield PB-(CAG-cHA-IRES-hyg; Acr-EGFP); next, an insert from pTagRFP-N1 (Evrogen) was introduced into PB-(CAG-cHA-IRES-hyg; Acr-EGFP). To generate pCAG-hyPBase, pCMV-hyPBase [18] (link) was cloned into blunt-ended pCAGGS [10] (link). Primer sequences are shown in Table S1 .
Ptagrfp n1
Manufactured by Evrogen
PTagRFP-N1 is a fluorescent protein derived from the sea anemone Entacmaea quadricolor. It exhibits red fluorescence and can be used as a reporter or fusion tag in various biological applications.
Automatically generated - may contain errors
Lab products found in correlation
Ptre3g ires, by Takara Bio (1 mentions)
Pcmv tet3g, by Takara Bio (1 mentions)
Pgbkt7 vector, by Takara Bio (1 mentions)
Pgadt7 vector, by Takara Bio (1 mentions)
Block it pol 2 mir rnai expression vector kit, by Thermo Fisher Scientific (1 mentions)
Block it rnai designer tool, by Thermo Fisher Scientific (1 mentions)
Pecfp c1, by Takara Bio (1 mentions)
3 protocols using ptagrfp n1
1
Generating Plasmid Constructs for Inducible Gene Expression
2
Plasmid Construct Cloning Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Construction of the PB-TET-OKS and PB-TET-c-Myc vectors was described in previous reports [26] (link)–[28] (link). To construct PB-(CAG-rtTA_Adv; EOS-C(3+)-EGFP-IRES-puro), an insert from PB-EOS-C(3+)-EiP [26] (link), [29] (link) was introduced into PB-CAG-rtTA_Adv [26] (link), [28] (link). To construct PB-(CAG-TagRFP-IRES-hyg; Acr-EGFP), an insert from pAcr3-EGFP [30] (link) was introduced into the empty PB vector. The resultant vector (PB-Acr-EGFP) was amplified by PCR, the amplified DNA fragment was cloned into PB-CAG-cHA-IRES-hyg, and an insert from pTagRFP-N1 (Evrogen) was introduced into the resultant vector (PB-[CAG-cHA-IRES-hyg; Acr-EGFP]). To construct pCAG-hyPBase, an insert from pCMV-hyPBase [15] (link) was cloned into pCAGGS [31] (link). Primer sequences are shown in Table S1 .
3
Mammalian Protein Expression and Interaction Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To obtain CRMP2-ECFP and KIF3B-TagRFP mammalian expression vector plasmids, the respective full-length mouse cDNAs were ligated with pECFP-C1 (Clontech) and pTagRFP-N1 (Evrogen) vectors and prepared with an endotoxin-free plasmid DNA purification kit (MACHEREY-NAGEL).
For expression of the recombinant CRMP2 protein in E. coli, the CRMP2-pET-21b vector was constructed as previously described (Toyoshima et al., 2019) .
A miRNA-based mouse CRMP2 knockdown vector with the target sequence CATGATCATTGACCATGTTGT was designed and prepared using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) and the pcDNA6.2-GW/miR vector from a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Thermo Fisher). The knockdown efficiency was verified by immunofluorescence microscopy.
For the yeast two-hybrid assays, mouse Kif3a (369-701 aa, 600-701 aa) and Kif3b (470-747 aa, 592-747 aa) cDNA fragments were amplified by PCR and ligated with the pGBKT7 vector (Takara Bio) to serve as the bait, and CRMP2 (1-249 aa, 312-572 aa) cDNA fragments were amplified by PCR and ligated with the pGADT7 vector (Takara Bio) to serve as the prey.
For expression of the recombinant CRMP2 protein in E. coli, the CRMP2-pET-21b vector was constructed as previously described (Toyoshima et al., 2019) .
A miRNA-based mouse CRMP2 knockdown vector with the target sequence CATGATCATTGACCATGTTGT was designed and prepared using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) and the pcDNA6.2-GW/miR vector from a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Thermo Fisher). The knockdown efficiency was verified by immunofluorescence microscopy.
For the yeast two-hybrid assays, mouse Kif3a (369-701 aa, 600-701 aa) and Kif3b (470-747 aa, 592-747 aa) cDNA fragments were amplified by PCR and ligated with the pGBKT7 vector (Takara Bio) to serve as the bait, and CRMP2 (1-249 aa, 312-572 aa) cDNA fragments were amplified by PCR and ligated with the pGADT7 vector (Takara Bio) to serve as the prey.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!