Mut express 2 fast mutagenesis kit v2 system

For knockdown of DHCR24, two different DHCR24 short hairpin RNAs (shRNAs) (sh11 and sh12) were inserted into the PLKO.1‐puro vector using standard DNA cloning techniques. The 2 DHCR24 shRNA sequences are: sh11, 5'‐GCTCTCGCTTATCTTCGATAT‐3'; sh12, 5′‐GCAGAGCTCTACATCGACATT‐3'. The PLKO.1‐control shRNA plasmid was used as described.²⁷ For overexpression of DHCR24, DHCR24 cDNA was inserted into the pBabe‐hygro plasmid using PCR and standard DNA cloning techniques. To construct the constitutively activated mutant of SMO, pcDNA3.1‐SMO‐3xFlag plasmid was purchased from YouBio and used as a template to generate pcDNA3.1‐SMO^W535L‐3xFlag plasmid using the Mut Express® II Fast Mutagenesis Kit V2 System (Vazyme). The Flag‐SMO^W535L insert was amplified by standard PCR and inserting into the pBabe‐puro plasmid.²⁷ Primer sequences for point mutagenesis are: forward 5′‐GAGCACCTtGGTCTGGACCAAGGCCACGCTG‐3′; reverse 5′‐CAGACCaAGGTGCTCATGGCGATGCCAGTTCC‐3′. Primer sequences for subcloning into pBabe‐puro plasmid are: forward 5′‐CCGGAATTCGCTAGTT‐AAGCTTGGTAC‐3′; reverse 5′‐CAGGTCGACTCACTTGTCATCGTCATC‐3′. All of the generated plasmids were verified by DNA sequencing.