Sepasol rna super g

ATMSC, EPC, HUVEC, MDA-MB-231 cells, and MCF7 cells were treated with EV or CM as described above. Sepasol-RNA Super G (Nacalai Tesque) was added according to the manufacturer’s instructions to isolate the total RNA, followed by reverse transcription into cDNA using a ReverTra Ace qPCR RT kit (Toyobo, Kita, Osaka, Japan). Two microliters of the cDNA were amplified with the THUNDERBIRD SYB qPCR Mix (Toyobo) via the Real-time PCR system QuantStudio 5 (Thermo Fisher Scientific). The samples were denatured for 10 min at 95°C followed by 15 s cycles of denaturation at 95°C. Finally, 30 s of annealing and extension was performed at 60°C. The level of gene expression in each sample was analyzed using the ΔΔCt method (formula 2^-ΔΔCT) and normalized to ACTB (β-actin) gene expression. The primers were listed in Table 1.

RNA was extracted from frozen lung blocks by using Sepasol-RNA Super G (Nacalai Tesque) and from cultured cells by using RNA extraction columns (NucleoSpin RNA II, Takara Bio, Shiga, Japan). Reverse transcription-PCR was performed to obtain cDNA. Then, reverse transcription-quantitative polymerase chain reaction (qPCR) was performed by using SYBR Premix ExTaq (Takara Bio) with specific primers (Life Technologies Japan, Tokyo, Japan) (Table 1) under the following conditions: 30 s at 95 °C and 40 cycles for 5 s at 95 °C and 30 s at 60 °C (iCycler, Bio-Rad Laboratories, Hercules, CA). Changes in HIF1A, vascular endothelial growth factor A (VEGFA), and glucose transporter-1 (GLUT1) mRNA expressions relative to β-actin (ACTB) mRNA expression were calculated.Table 1

Primers for qPCR

Gene	Primer	Sequence
Mouse HIF1A	Forward	5′-ATCAAGTCAGCAACGTGGAA-3′
	Reverse	5′-AATGGGTTCACAAATCAGCAC-3′
Rat and mouse VEGFA	Forward	5′-TGCTGTACCTCCACCATGC-3′
	Reverse	5′-GATGTCCACCAGGGTCTCAA-3′
Rat GLUT1	Forward	5′-CCCTGCAGTTCGGCTATAA-3′
	Reverse	5′-AGTGTGGTGAGTGTGGTGGA-3′
Mouse GLUT1	Forward	5′-TTATTGCCCAGGTGTTTGG-3′
	Reverse	5′-GTTACGATTGATGAGCAGGAAG-3′
Rat ACTB	Forward	5′-TGACGTTGACATCCGTAAAGAC-3′
	Reverse	5′-AGAGCCACCAATCCACACA-3′
Mouse ACTB	Forward	5′-TGACAGGATGCAGAAGGAGA-3′
	Reverse	5′-GCTGGAAGGTGGACAGTGAG-3′

Total RNA was extracted using Sepasol®-RNA Super G (Nacalai Tesque Inc.) according to the manufacturer’s instructions. The reverse transcription (RT) reaction was performed using a ReverTra Ace® qRT-PCR Master Mix (TOYOBO) according to the manufacturer’s instructions. RT products were analyzed using a THUNDERBIRD® qPCR Mix (TOYOBO) and the StepOne real-time PCR system (Applied Biosystems) with the primer sets listed in Supplementary Table S2 according to the manufacturer’s instructions. The expression level of each mRNA was normalized to that of mouse or human GAPDH. At least three biological experiments were carried out and data are presented as means ± SD.

TGF-β1, connective tissue growth factor (CTGF), procollargenI, procollargen III, matrix metalloproteinase 2 (MMP2), MMP9, tissue inhibitor of metalloproteinase 1 (TIMP1), TIMP2, HIF-1α and vascular endothelial growth factor (VEGF) mRNA expression levels in the liver were measured in the PAB (n = 4) and sham-operated control (n = 4) groups using real-time PCR. A liver fragment was immersed in 1 mL of Sepasol-RNA Super G (NACALAI TESQUE, Japan) and crushed using a bead-type homogenizer. After centrifugation at 12,000 g at 4°C for 15 minutes, the supernatant was collected and total RNA was extracted following the instructions attached to the kit. cDNA was synthesized using a TaKaRa PCR Thermal Cycler Dice ^™ (TAKARA BIO, Japan), and RT-PCR was performed using a Thermal Cycler Dice ^® and SYBR ^® Premix Ex Taq^™ (TAKARA BIO, Japan). The nucleotide sequences of the primers used are shown in Table 1. The 18S rRNA expression level was quantitated as an internal reference. Both isolation of total RNA from pooled tissues and generation of cDNA and reverse transcription-PCR analysis were performed as described previously [15 ].

Total RNA was extracted using Sepasol®-RNA Super G (Nacalai Tesque), and then reverse transcribed by extension with random hexamer primers, using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qRT-PCR was performed using THUNDERBIRD® SYBR® qPCR Mix (TOYOBO) with the following primers: β-tubulin (Forward; TATGTACCTCGGGCCATCC, Reverse; TTATTTCCTGCACCACTCTGG), FoxO3a (Forward; GATAAGGGCGACAGCAACAG, Reverse; CATTCTGAACGCGCATGA), FoxO1 (Forward; CTTCAAGGATAAGGGCGACA, Reverse; GACAGATTGTGGCGAATTGA), Rictor (Forward; CACAAGCCCTTCGCTTAGTC, Reverse; GTTCACAGATGATGGCGATG), p27^Kip1 (Forward; GTTAGCGGAGGCAGTGTCCA, Reverse; TCTGTTCTGTTGGCCCTTTT), and SGK1 (Forward; GGACTACATTAATGGTGGAGAGC, Reverse; AGAATCGAGCCCGTGGTT).

OSCC and SiSo cells were cultured in 10 cm dishes to 70–80% confluence. Total RNA was then extracted from cultured cells that were harvested with a cell scraper using Sepasol-RNA Super G (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. Primers were chosen through the GenBank sequence database (NCBI, Bethesda, MD, USA). Primer pairs for RCAS1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are listed in Table 
1. All oligonucleotides used as primers were synthesized by Genenet Co., Ltd (Fukuoka, Japan). After reverse transcription with isolated mRNA, reaction products were subjected to 28 cycles of PCR for RCAS1 and GAPDH at 15 seconds at 94°C for denaturation, 30 seconds at 60°C for annealing, and 60 seconds at 68°C for extension. PCR products were electrophoresed on 2% agarose gels. Bands were visualized by using ethidium bromide. Experiments were made in triplicate. Luminosity values were quantified using ImageJ software (NIH, Bethesda, MD, USA). Mean values of triplicate measurements were calculated.

To investigate the gene expression at the transcriptional level, qRT-PCR was carried out. MDA-MB-231 and MCF-7 cells were seeded into each well of a 6-well plate at 5×10⁵ cells/1 ml/well in culture medium and incubated for 1 hour before being treated with M protein. After 24 hours, total RNA was isolated using Sepasol-RNA Super G (Nacalai Tesque) according to the instruction of the manufacturer. 2 μg of total RNA sample was reverse transcribed into cDNA using RT-PCR ReverTra Ace qPCR RT kit (Toyobo, Kita, Osaka, Japan). 2 µl of cDNA templates was subjected to realtime PCR amplification using THUNDERBIRD SYBR qPCR Mix (Toyobo) in Real-time PCR system QuantStudio 5 (Thermo Fisher Scientific). The qPCR program comprised an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of denaturation step at 95°C for 15s, annealing and extension step at 60°C for 30s. The sequences of qPCR primers for analysis were listed in Table 1. The expression levels of target genes were analyzed using the ΔΔCt method and normalized to the expression level of internal control housekeeping gene ACTB (β-actin) in each sample by the formula 2^-ΔCt.