An HK2 3′UTR-Luc reporter was created by ligating the HK2 3′UTR PCR product into the XbaI site of the pGL3 control vector (Invitrogen). A mutant reporter was generated from pGL3-WT-HK2 3′UTR-Luc by deleting the binding site for miR-181b ‘UGAAUGU’. A 1.9 kb fragment upstream of human pri-miR-181b stem-loop was constructed into pGL3-basic plasmids (Invitrogen). Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA).
Pgl3 control vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PGL3 control vector is a plasmid used in laboratory research. It serves as a control to evaluate the performance of other experimental plasmids. The PGL3 control vector contains a promoter and reporter gene, allowing researchers to assess basic transcriptional and translational activity.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (9 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (6 mentions)
Dual luciferase assay system, by Promega (2 mentions)
Km101, by Tiangen Biotech (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
Mir 98 inhibitor, by GenePharma (1 mentions)
Scramble control sirna, by GenePharma (1 mentions)
Scramble sirna, by GenePharma (1 mentions)
Pgl3 basic vector, by Thermo Fisher Scientific (1 mentions)
Control mimic, by Thermo Fisher Scientific (1 mentions)
Control inhibitor, by Thermo Fisher Scientific (1 mentions)
Mir 29b mimic, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay, by Promega (1 mentions)
Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Mir 494 mimic, by GenePharma (1 mentions)
Double luciferase report analysis system, by Promega (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Pgl3 luciferase reporter vector, by Promega (1 mentions)
20 protocols using pgl3 control vector
1
Regulation of HK2 Expression by miR-181b
2
Regulation of FSTL1 Expression by miR-27a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human FSTL1 3′-UTR was amplified and cloned into the XbaI site of the pGL3-control vector (Invitrogen), downstream of the luciferase gene, to generate the pGL3-FSTL1-3′UTR plasmid. In addition, pGL3-FSTL1-3′UTR-mut plasmids were constructed using cDNA fragments containing corresponding mutated nucleotides for miR-27a as a control. For the luciferase reporter assay, FLS were co-transfected with 100 ng of the luciferase reporter vectors and 20 pmol of control mimic, miR-27a mimic, control inhibitor, or miR-27a inhibitor using Lipofectamine 2000 (Invitrogen). The β-actin promoter Renilla luciferase reporter was used for normalization. After 48 h, luciferase activity was analyzed using the Dual-Luciferase Assay System (Promega).
3
Regulation of DKK1 Promoter by HOXC6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 2 kb sequence of the DKK1 promoter (retrieved from the Ensembl database, www.ensembl.org ) containing the predicted HOXC6 recognition motif (TATTTAAT, described previously17 (link),18 (link)) was amplified by PCR using genomic DNA from HCT116 cells (forward sequence 5′ to 3′ CAGCTAGCACTTTCTCTTCTTTTGCCCCAGG, reverse sequence 5′ to 3′ AGAGCTCCTGACTGCAGGGAGCACAGA). The PCR product was then cloned into the pGL3 control vector (Invitrogen) by using the NheI and SacI restriction sites. A mutant of the predicted HOXC6 recognition motif (CGAACCAG) within the DKK1 promoter was synthesized using a fast site-directed mutagenesis kit (TIANGEN, KM101). The HOXC6 sequence was amplified by PCR using complementary DNA of total RNA extracted from HCT116 cells (forward sequence 5′ to 3′ ATGCAGCTAGCATGAATTCCTACTTCACTAACCCTTCCT, reverse sequence 5′ to 3′ TCGAAGCTTTCACTCTTTCTGCTTCTCCTCTTCTGT). The PCR product was then cloned into the pcDNA3.1 (-) vector (Invitrogen) at the NheI and HindIII restriction sites.
For the luciferase activity detection assay, HEK293T cells were co-transfected with a vector containing the wild-type (WT) or mutant promoter of DKK1 and the pcDNA3.1 (-) vector containing HOXC6 or the pcDNA3.1 (-) vector control and cultured. After 48 h, the dual luciferase activities were examined using the Dual-Luciferase Reporter Assay System (Promega, Cat. #E1910).
For the luciferase activity detection assay, HEK293T cells were co-transfected with a vector containing the wild-type (WT) or mutant promoter of DKK1 and the pcDNA3.1 (-) vector containing HOXC6 or the pcDNA3.1 (-) vector control and cultured. After 48 h, the dual luciferase activities were examined using the Dual-Luciferase Reporter Assay System (Promega, Cat. #E1910).
4
Fas Promoter and 3'-UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human Fas promoter (from −1780 bp to +1 bp) region was amplified from HEK293 cell genomic DNA and subcloned into the pGL3 basic vector (Promega) upstream of the luciferase gene. The full-length human (2.6 kb) or mouse (0.45 kb) Fas 3′-UTR was amplified from HEK293 cell or C57BL/6 mouse genomic DNA, respectively, and subcloned into a pGL3-control vector (Invitrogen). Cells were cotransfected with 50–100 ng of the indicated reporter construct and 2.0 ng of pRenilla. Twenty-four hours after DNA transfection, the cells were harvested and analyzed using a dual-luciferase reporter assay kit (Promega). Firefly luminescence signals were normalized according to the corresponding Renilla signals, resulting in the calculation of relative luciferase activity. Mean luciferase activity levels were derived from three independent experiments.
5
Examining MeCP2 Regulation via miR-98
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Mecp2 3′-UTR and Mecp2 3′-UTR-mutant sequences were amplified by PCR from human genomic DNA using the primers in Table 2 . After being double digested with SpeI and XbaI, the PCR products were cloned into pGL3 control vector (Invitrogen, Carlsbad, CA, USA). The coding region of Mecp2 sequence was amplified by RT-PCR from total mRNA of human JEG-3 cells using the primers in Table 2 . After being double digested with BamHI and EcoRI, the PCR product was cloned into PMSCV-puro vector, designated as PMSCV-Mecp2. All the constructs were verified by DNA sequencing. Specific siRNAs for scramble and Mecp2 were synthesized as a duplex with the following sequence: scramble siRNA, 5′-CUUCUUAGGUGGUUUCUGC-dTdT-3′, Mecp2 siRNA, 5′-GCAGAAACCACCUAAGAAG- dTdT-3′.
The miR-98 mimic, mimic control, miR-98 inhibitor, inhibitor control, scramble siRNA control and Mecp2 siRNA were synthesized by GenePharma (GenePharma Co., Ltd, Shanghai, China), and transfected into cells by the lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacture’s instruction.
The miR-98 mimic, mimic control, miR-98 inhibitor, inhibitor control, scramble siRNA control and Mecp2 siRNA were synthesized by GenePharma (GenePharma Co., Ltd, Shanghai, China), and transfected into cells by the lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacture’s instruction.
6
Assaying miR-7 Regulation of IGF-1R 3′-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IGF-1R 3′-untranslated region (UTR)-Luc reporter assay was performed by ligating the IGF-1R 3′-UTR PCR product into the XbaI site of the pGL3 control vector (Invitrogen). The mutant-type reporter was generated by deleting the binding site of miR-7 “GUCUUCC.” The cells were co-transfected with wild-type (pGL3-WT-IGF-1R-3′-UTR) or mutant-type (pGL3-MUT-IGF-1R-3′-UTR) luciferase reports and miR-7 mimic or miR-NC. After 48 h of incubation, luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega, Madison, USA).
7
Validating let-7b Binding to PBX3 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine whether let-7b directly binds to the PBX3 3′-UTR, dual luciferase reporter assays were conducted. Wild-type (WT) and mutated putative let-7b-binding sites were amplified and cloned into the XbaI site of a pGL3 control vector (Invitrogen). The following reporter assays were performed in a regular way as our previously described [26 (link)].
8
Characterization of miR-128 Binding Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SP1 3′-UTR has two miR-128 binding sites: 1662 to 1669(AGAGA------CACUGUGA) and 4516 to 4522(CACUGUG). Two wild–type (WT) luciferase reporter plasmids and two mutants (ACACA------GAGUCUCA and GAGUCUC) were constructed and inserted into pGL3–control vector (Invitrogen). The miR-128b promoter region containing SNAI1-binding sequence (---CACATG---) was inserted into pGL3-basic vector along with the three corresponding mutants (---GTGTAC---) (Invitrogen), as previously described [23] (link). After 48 h following transfection, dual-Luciferase Reporter Assay System (Promega) was used to detect luciferase activity in accordance with product specification.
9
CCND1 Promoter Regulation by FOXA1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The promoter region (−2000 to +200) of CCND1 was amplified and cloned into pGL3 control vector (Invitrogen). HEK-293T cells were placed in a 24-well plate and co-transfected with CCND1 luciferase reporter, Renilla and vector or FOXA1 (0.5 μg, 1 μg and 2 μg). After transfection for 24 h, the luciferase activity was determined using the Promega Dual Luciferase Reporter Assay System (Madison, WI, USA) according to manufacturer’s instructions. Each sample was examined in triplicate.
10
Regulation of HIF3A by miR-29b
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ING2, ING3, HIF3A 3′-UTR, and HIF3A 3′-UTR-mutant sequences were amplified by PCR from human genomic DNA using the primers in Table 2 . After being double digested with XhoI and XbaI, the PCR products were cloned into pGL3 control vector (Invitrogen, Carlsbad, CA, USA). The coding region of HIF3A sequence was amplified and cloned into pcDNA3.1 vector, designated as pcDNA3.1-HIF3A. All the constructs were verified by DNA sequencing. Specific siRNAs for scramble and HIF3A were purchased from RiboBio Co., Ltd. (Guangzhou, Guangdong, China).
The miR-29b mimic, mimic control, miR-29b inhibitor, inhibitor control, scramble siRNA control and HIF3A siRNA were synthesized by GenePharma (GenePharma Co., Ltd., Shanghai, China), and transfected into cells by the lipofectamine 2,000 (Invitrogen, Carlsbad, CA, USA) according to the manufacture's instruction.
The miR-29b mimic, mimic control, miR-29b inhibitor, inhibitor control, scramble siRNA control and HIF3A siRNA were synthesized by GenePharma (GenePharma Co., Ltd., Shanghai, China), and transfected into cells by the lipofectamine 2,000 (Invitrogen, Carlsbad, CA, USA) according to the manufacture's instruction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!