Primescript first strand complementary dna cdna synthesis kit

Total RNA was extracted using Trizol reagent (Invitrogen). The optical density (OD) 260/230 ratio of RNA was >1.8 that was obtained by ultraviolet/visible spectrophotometer (Yiipu Instruments, China). Primescript first-strand complementary DNA (cDNA) synthesis Kit (Takara) was used to reverse transcribe RNA into cDNA according to the Kit Proposal. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) experiments were performed on the Applied Biosystems 7500 PCR instrument according to the steps of the real-time fluorescence quantitative Kit (Takara). The upstream primer of tRF-Glu-TTC-2 was acatggttagcggttagga, and the downstream primer was ttcccacaccgggagtcgaa. The internal reference of tRF is U6. The upstream primer of U6 was tgcgggtgctcgcttcggcagc, and the downstream primer was attaaccaggtgcagggtcgaggt.

Total cellular RNA was isolated using Trizol reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. Reverse transcription was performed using PrimeScript first strand complementary DNA (cDNA) Synthesis Kit (TaKaRa, Otsu, Japan) following the manufacturer’s protocol. PCR analysis of TMPRSS2–ERG expression was performed using a program with 35 cycles of 98°C for 10 seconds, 68°C for 30 seconds, and 72°C for 45 seconds.
The PCR products were electrically mobilized in a 1.5% agarose gel and the DNA bands were visualized using gel documentation system (Scinomics, Daejeon, Republic of Korea). The DNA band intensity was analyzed as an unsaturated image using ImageJ software. The RT-PCR results were additionally confirmed by DNA sequencing. The sequences of used primers for RT-PCR and sequencing are as follows: TMPRSS2–ERG forward, 5′-CAGGAGGCGGAGGCGGA-3′; TMPRSS2–ERG reverse, 5′-GGCGTTGTAGCTGGGGGTGAG-3′.

Isobutyl methylxanthine, dexamethasone, insulin, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), ORO, 1,3,3-tetraethoxypropane, Nile red [9-diethylamino-5-benzo(α)phenoxazinone], and Griess reagent were purchased from Sigma (St. Louis, MO, USA). RNAiso Plus, PrimeScript first-strand complementary DNA (cDNA) synthesis kit, and SYBR Premix Ex Taq real-time PCR kit were purchased from Takara Bio Inc. (Otsu, Shiga, Japan). Antibodies against PPARγ, CCAAT/enhancer-binding protein-alpha (C/EBPα), phospho-Akt (Ser473), and Akt were purchased from Cell Signaling Technology (Danvers, MA, USA). Primary antibody for β-actin was obtained from Sigma. Horseradish peroxidase (HRP)-conjugated antimouse and antirabbit immunoglobulin G (IgG) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Extracts of SG, RG, and WG were provided by Ginseng Science Inc. (Seoul, Korea).