Interleukin 2 (il 2)

Manufactured by Cell Signaling Technology

Sourced in United States

IL-2 is a recombinant protein that functions as an interleukin-2 cytokine. Interleukin-2 is a signaling molecule that plays a crucial role in the activation and proliferation of T cells, which are essential for adaptive immune responses.

Automatically generated - may contain errors

Lab products found in correlation

Phorbol myristate acetate (pma), by Merck Group (2 mentions) Ionomycin, by Merck Group (2 mentions) Golgistop, by BD (2 mentions) Anti il 2, by BD (1 mentions) Anti il 6, by BioLegend (1 mentions) Facscalibur, by BD (1 mentions) Cd3 percp, by BioLegend (1 mentions) Cd4 pe, by BioLegend (1 mentions) Lipopolysaccharides (lps), by Merck Group (1 mentions) Anti ifn γ, by BD (1 mentions) Anti tnf α, by BioLegend (1 mentions) Cytofix cytoperm kit, by BD (1 mentions) Sodium pyruvate, by Corning (1 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Amaxa nucleofector, by Lonza (1 mentions) L glutamine, by Thermo Fisher Scientific (1 mentions) Non essential amino acids (neaa), by Thermo Fisher Scientific (1 mentions) Hepes solution, by Thermo Fisher Scientific (1 mentions) Interleukin 2 (il 2), by STEMCELL (1 mentions)

6 protocols using interleukin 2 (il 2)

Phenotyping Immune Cells via Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated monocytes (10⁵) and PBMCs were incubated with 100 ng/ml LPS (Sigma Aldrich), 5 ng/ml IL-2 (Cell Signaling Technologies), 50 ng/ml phorbol-12-myristate-13-acetate (PMA, Merck), and 1 μg/ml ionomycin (Sigma Aldrich) for 37℃, 5 h, respectively; and GolgiStop (BD Biosciences) was added for the final 3 h. Monocytes were stained with FITC-CD14 and PerCP-CD16 (Biolegend), and PBMCs were stained with FITC-CD45RO, PE-CD4, PerCP-CD3, and APC-CCR7 for 30 min. Cells were fixed and permeabilized using the protocol from the Cytofix/Cytoperm kit (BD Biosciences). Then, the monocytes were stained with anti-TNF-α (Biolegend) and anti-IL-6 (Biolegend), and the PBMCs were stained with anti-IFN-γ (BD Biosciences) and anti-IL-2 (BD Biosciences) for 30 min.
Expression of cell-surface markers was assessed using flow cytometry (FACSCalibur, BD, USA) after gating of live cells, and analyzed according to scatter characteristics using FlowJo software.

Ren X., Mou W., Su C., Chen X., Zhang H., Cao B., Li X., Wu D., Ni X., Gui J, & Gong C. (2017). Increase in Peripheral Blood Intermediate Monocytes is Associated with the Development of Recent-Onset Type 1 Diabetes Mellitus in Children. International Journal of Biological Sciences, 13(2), 209-218.

+ Open protocol

+ Expand

Characterization of NK Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

NK92-dependent interleukin-2 (IL-2) Natural killer cell line is derived from rapidly progressive non-Hodgkin’s lymphoma cells, these cells expresses the following surface marker CD2, CD7, CD11a, CD28, CD45, CD54, this cell line not express CD1, CD3, CD4, CD5, CD8, CD10, CD14, CD16, CD19, CD20, CD23, CD34, and HLA-DR.^{56 (link)} NK92 cells were cultured at 37°C in Myelocult H5100 medium (StemCell technologies) supplemented with Penicillin/Streptomycin (Gibco Life technologies) and 100 U/mL IL-2 (Cell Signaling).
The natural killer cell lymphoblastic leukemia (YTS) cell line expressing CD56,^{57 (link)} was cultured at 37°C in RPMI 1640 (Gibco Life Technologies) supplemented with Penicillin/Streptomycin (Gibco Life Technologies), non-essential amino acids (Gibco Life Technologies), 1mM Sodium Pyruvate (Corning Cellgro), 1M HEPES solution (Gibco Life Technologies), and L-Glutamine (Gibco Life Technologies). STAT1 mutant NK cell lines were generated by CRISPR-Cas9 gene editing and performed by nucleofection of 5 ug of GeneArt CRISPR Nuclease Vector plasmid containing the guide sequences ATCACTCTTTGCCACACCATGTTT, ACTGTTGGTGAAATTGCAAGTTTT, and TTCAGCCGCCAGACTGCCATGTTTT (Life Technologies) using the Amaxa nucleofector and Lonza-Kit R. 24 hours post-nucleofection GFP positive cells were sorted. Single clones were expanded and STAT1GOF positive cells were confirmed by flow cytometry.

Vargas-Hernandez A., Mace E.M., Zimmerman O., Zerbe C.S., Freeman A.F., Rosenzweig S., Leiding J.W., Torgerson T., Altman M.C., Schussler E., Cunningham-Rundles C., Chinn I.K., Carisey A.F., Hanson I.C., Rider N.L., Holland S.M., Orange J.S, & Forbes L.R. (2017). Ruxolitinib partially reverses functional NK cell deficiency in patients with STAT1 gain-of-function mutations. The Journal of allergy and clinical immunology, 141(6), 2142-2155.e5.

+ Open protocol

+ Expand

Quantifying STAT1 and STAT5 Phosphorylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

assays STAT1 phosphorylation was measured by flow cytometry after stimulation with IFNα (10 ng/mL-Millipore) for 30, 60, and 120 minutes. STAT5 phosphorylation was measured after stimulation with IL-2 (10 ng/mL, Cell Signaling) for 30. In the final 30 minutes of activation cells were stained with anti-CD3 and anti-CD56 antibodies (Biolegend). After these times the cells were fixed with Fixation Buffer (BD Biosciences) for 10 minutes at 37°, washed with Stain buffer (BD Biosciences) and permeabilized with Perm Buffer III (BD Biosciences) for 30 minutes on ice. Cells were stained with pY701-STAT1 AlexaFluor 488, and pY694-STAT5 Alexa Fluor 647 (BD Phosflow) antibodies. The samples were collected with LSR Fortessa cytometer (BD) and analyzed with FlowJo software (TreeStar, Ashland, Ore, USA).

+ Open protocol

+ Expand

Investigating NF-κB2 Activation in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total PBMCs were stimulated with anti-CD3 (OKT3, 1ug/mL; eBioscience; 16–0037-85) for 48 hours. Cells were washed with PBS once and lysed in lysis buffer (50mM Tris pH 7.4, 150mM NaCl, 2mM EDTA, 0.5% Triton X-100 and 0.5% NP40 and halt protease and phosphatase inhibitor cocktail [Sigma]) and samples were adjusted to have equal concentration of total protein and subjected to immunoblotting. Cell lysates were prepared and analyzed with anti-phospho-NFKB2 (S866/S870, Cell signaling #4810) and anti-NFKB2 (Cell Signaling Technology #3017) as previously described [6 (link)]. For the T cells blasts, total PBMCs were stimulated with anti-CD3 and anti-CD28 (1ug/mL; eBioscience) in the presence of IL-2 (10 ng/ml, Cell Signaling Technology) and cultured for 6–7 days. IL-2 was added every 2–3 days.

Kuehn H.S., Bernasconi A., Niemela J.E., Almejun M.B., Gallego W.A., Goel S., Stoddard J.L., Sánchez R.G., Franco C.A., Oleastro M., Grunebaum E., Ballas Z., Cunningham-Rundles C., Fleisher T.A., Franco J.L., Danielian S, & Rosenzweig S.D. (2020). A Nonsense N –Terminus NFKB2 Mutation Leading to Haploinsufficiency in a Patient with a Predominantly Antibody Deficiency. Journal of Clinical Immunology, 40(8), 1093-1101.

+ Open protocol

+ Expand

Cytokine profiling of stimulated PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMCs were stimulated with 5 ng/ml IL-2 (Cell Signaling), 50 ng/ml PMA (Merck), 1 μg/ml ionomycin (Sigma Aldrich), and GolgiStop (BD Biosciences) was added for the final 5 hours. PBMCs were stained with anti-human TCRγδ and CXCR5. PBMCs were then fixed using a BD Perm/Fix intracellular staining kit. PBMCs were then stained with IL-4 (MP4-25D2), IL-10 (JES3-9D7), IFNγ (4S.B3) (all from Biolegend, San Diego, CA, USA) and IL-2 (MQ1-17H12, BD Biosciences, San Diego, CA, USA) at room temperature for 30 min at dark. Data were collected by flow cytometry on a FACScalibur and were analyzed with FlowJo software (TreeStar).

Mou W., Han W., Ma X., Wang X., Qin H., Zhao W., Ren X., Chen X., Yang W., Cheng H., Wang X., Zhang H., Ni X., Wang H, & Gui J. (2017). γδTFH cells promote B cell maturation and antibody production in neuroblastoma. BMC Immunology, 18, 36.

+ Open protocol

+ Expand

Immunological Modulation by NAC

Check if the same lab product or an alternative is used in the 5 most similar protocols

N-Acetylcysteine (NAC) and ConA were purchased from Sigma–Aldrich (St. Louis, MO, USA). Enzyme-linked immunosorbent assay (ELISA) kits for detecting IL-2, IL-6, and TNF-α and IFN-γ were purchased from R&D Systems (Minneapolis, MN, USA). The antibodies used in this study include Akt, p-Akt, IL-2, IL-6, TNF-α, IFN-γ, NF-κB, LC3II, Beclin 1, IκB-α, and IκB-β (Cell Signaling Technology, Beverly, MA, USA). The RNA PCR kit was purchased from Takara Biotechnology (Dalian, China).

Wang C., Xia Y., Zheng Y., Dai W., Wang F., Chen K., Li J., Li S., Zhu R., Yang J., Yin Q., Zhang H., Wang J., Lu J., Zhou Y, & Guo C. (2015). Protective Effects of N-Acetylcysteine in Concanavalin A-Induced Hepatitis in Mice. Mediators of Inflammation, 2015, 189785.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!