RNA was extracted from cells using the RNeasy Mini Kit or the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed using the M-MLV reverse transcriptase (Invitrogen) or the iScript cDNA synthesis kit (Bio-rad). qPCR was performed either with TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) and TaqMan probes (Thermo Fisher Scientific), or with iQ™ SYBR Green Supermix (Bio-rad). For TaqMan method, the following assays were used: human ACTB Hs99999903_m1; human c-MYC Hs00153408_m1; human HK2 Hs00606086_m1; mouse Actb Mm02619580_g1; mouse Hk1 Mm00439344_m1; mouse Hk2 Mm00443385_m1. For SYBR method, qPCR primers for human FGFR1-FGFR4, human GAPDH, human β-ACTIN, mouse Fgfr1-Fgfr4, mouse Hk1 and mouse β-Actin were ordered from Qiagen. Mouse Hk2 qPCR primers both purchased from Qiagen and designed in-house were used to generate data for Fig. 2k . The sequences of in-house designed qPCR primers are (5’ to 3’): Mouse Hk2 (CGGTACACTCAATGACATCCGA; TTCACCAGGATGAGTCTGACC) and human RPLP0 (TCTGCATTCTCGCTTCCTGG; CAGGACTCGTTTGTACCCGT).
Mouse hk2 qpcr primers
Manufactured by Qiagen
The Mouse Hk2 qPCR primers are a set of oligonucleotides designed for the quantitative real-time PCR (qPCR) detection and quantification of the mouse hexokinase 2 (Hk2) gene expression. These primers are intended for use in molecular biology applications requiring the analysis of mouse gene expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Taqman probe, by Thermo Fisher Scientific (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Qpcr primers for human fgfr1 fgfr4, by Qiagen (2 mentions)
Human β actin, by Qiagen (2 mentions)
Mouse fgfr1 fgfr4, by Qiagen (2 mentions)
2 protocols using mouse hk2 qpcr primers
1
Comprehensive Gene Expression Analysis
2
Comprehensive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using the RNeasy Mini Kit or the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed using the M-MLV reverse transcriptase (Invitrogen) or the iScript cDNA synthesis kit (Bio-rad). qPCR was performed either with TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) and TaqMan probes (Thermo Fisher Scientific), or with iQ™ SYBR Green Supermix (Bio-rad). For TaqMan method, the following assays were used: human ACTB Hs99999903_m1; human c-MYC Hs00153408_m1; human HK2 Hs00606086_m1; mouse Actb Mm02619580_g1; mouse Hk1 Mm00439344_m1; mouse Hk2 Mm00443385_m1. For SYBR method, qPCR primers for human FGFR1-FGFR4, human GAPDH, human β-ACTIN, mouse Fgfr1-Fgfr4, mouse Hk1 and mouse β-Actin were ordered from Qiagen. Mouse Hk2 qPCR primers both purchased from Qiagen and designed in-house were used to generate data for Fig. 2k . The sequences of in-house designed qPCR primers are (5’ to 3’): Mouse Hk2 (CGGTACACTCAATGACATCCGA; TTCACCAGGATGAGTCTGACC) and human RPLP0 (TCTGCATTCTCGCTTCCTGG; CAGGACTCGTTTGTACCCGT).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!