Prepman reagent

Effect of BV2-5 on baculovirus multiplication in cell culture was determined by a one-step growth curve assay. Sf21 cells were infected with the different recombinant baculoviruses at an MOI of 2. After infection, cells were washed and incubated in fresh medium. At different time points, an aliquot of medium was harvested and the viral titer (amount of budded viruses) in each sample was determined by qPCR. For that purpose, viral DNAs were extracted using Prepman reagent (Applied Biosystems) following the manufacturer protocol and were quantified by comparing the obtained Ct values against a standard curve of known viral concentration. Three independent replicates were performed for each sample.

Bacterial genomic DNA was extracted using PrepMan^® reagent (Applied Biosystems) according to the manufacturer's instructions. The 16S rRNA gene was amplified using primer pairs 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5′‐GGTTACCTTGTTACGACTT‐3′) (Frank et al., 2008). The PCR was performed using AccuPower^® PCR PreMix (Bioneer) in 25 μl reactions under cycling conditions consisting of an initial denaturation at 95^°C for 2 min followed by 30 cycles of denaturation at 94^°C for 45 s, annealing at 57^°C for 45 s and extension at 72^°C for 45 s; and a final extension at 72^°C for 10 min. Amplification products were run on 1% agarose‐0.5XTris‐Borate‐EDTA gels and PCR products were purified using a QIAquick PCR Purification Kit (Qiagen). Purified PCR products were sequenced using the ABI 48‐capillary 3730 DNA Analyzer (Applied Biosystems).