DNA from lungs of PbN-infected mice was extracted by illustra tissue & cells genomicPrep Mini spin kit (GE Healthcare). The primers of mouse endogenous gene, GAPDH (Forward: GGCAAATTCAACGGCACAGT and Reverse: AGATGGTGATGGGCTTCCC) and the Plasmodium berghei 18 s ribosomal 18 s gene (Forward: AAGCATTAAATAAAGCGAATACATCCTTA and 18 s Reverse: GGAGATTGGTTTTGACGTTTATGT) were used to determine the parasite load in the lungs by relative quantification, normalized with the mouse GAPDH (∆CT). The quantitative PCRs were carried out with the Platinum SYBR Green protocol (Invitrogen) on an Applied Biosystems 7500 real-time PCR system.
Platinum sybr green protocol
The Platinum SYBR Green protocol is a lab equipment product designed for real-time PCR applications. It provides a reliable and sensitive method for gene expression analysis and quantification.
3 protocols using platinum sybr green protocol
Pulmonary Inflammation and Parasite Load Analysis
DNA from lungs of PbN-infected mice was extracted by illustra tissue & cells genomicPrep Mini spin kit (GE Healthcare). The primers of mouse endogenous gene, GAPDH (Forward: GGCAAATTCAACGGCACAGT and Reverse: AGATGGTGATGGGCTTCCC) and the Plasmodium berghei 18 s ribosomal 18 s gene (Forward: AAGCATTAAATAAAGCGAATACATCCTTA and 18 s Reverse: GGAGATTGGTTTTGACGTTTATGT) were used to determine the parasite load in the lungs by relative quantification, normalized with the mouse GAPDH (∆CT). The quantitative PCRs were carried out with the Platinum SYBR Green protocol (Invitrogen) on an Applied Biosystems 7500 real-time PCR system.
Quantifying Liver Transcripts in Infected Mice
Gene Expression and Parasite Load Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!