Ez dna methylation lightning kit

The bisulfite conversion of DNA was performed using the EZ DNA Methylation-Lightning Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. The primers (Supplementary Table 3) used for the PCR amplification of both the methylated and unmethylated alleles were designed using the software Methprimer (https://www.urogene.org/cgi-bin/methprimer/methprimer.cgi). The amplified promoter region of HNF1B covers 15 CpG islands (the PCR product corresponding to the relative transcription start site -457 to -202, GRCh37), including a CpG island (chr17:36105517–36105518, GRCh37). In our setting, we were able to detect at least 5% of methylated DNA by High Resolution Melting (HRM) Analysis of the amplified PCR products. Each run included the converted DNA samples and a series of 100%, 20%, 10%, 5 and 0% universally methylated DNA controls mixed with non-methylated DNA (Human HCT116 DKO Non-Methylated DNA and Human HCT116 DKO Methylated DNA; Zymo Research). The melting curves of the analyzed samples were compared with the melting curves of the control mixes, as described elsewhere^{68 (link)}. Due to the unspecified quantity of tumor tissue in the sample if the methylation was detected by HRM analysis, the sample was considered to be methylated.

Bisulfite treatment of genomic DNA was carried out with the EZDNA Methylation-Lightning™ Kit (Zymo Research, cod. D5031) according to the manufacturer’s protocol.

Pellets collected from uninduced NT2/D1 cells and cells induced with RA for 2, 4 and 7 days were resuspended in TSM buffer [140 mM NaCl, 10 mM Tris (pH 7.4), 1.5 mM MgCl2, 0.5% NP40]. After short centrifugation, pellets were lysed in nuclei dropping buffer (75 mM NaCl, 24 mM EDTA, 0.2mg/ml proteinase K, 0.5% SDS). High molecular weight DNA was extracted using phenol-chlorophorm-isoamylalcohol extraction, and precipitated with sodium acetate and isopropanol.
Sodium-bisulfite conversion of isolated genomic DNA was performed using EZ DNA Methylation-Lightning^™ Kit (Zymo Research Corporation, CA, USA). For each conversion 2 μg of DNA was used and protocol provided by the manufacturer strictly followed. Upon conversion the reaction recovery rate was considered as 100% and hence concentration of DNA was not measured.

Genomic DNA for bisulfite sequencing was extracted according to Vejlupkova and Fowler (2003) with some modifications. Tissue for the SAP methylation analysis was isolated using a dissection microscope from FFPE sections of tomato shoot apices made according to Vitha, Baluška, Jasik, Volkmann, and Barlow (2000). Bisulfite treatment was carried out using the EZ DNA Methylation‐Lightning kit (Zymo Research). Bisulfite‐treated DNA was amplified using primers AAYTTTTGGGGTGTGAGTTAGA + TCCACCCATTTCATTAACCACC and GTGAGGTGGGGTGTTAAAGAATGA + CACCRATRTAACACTCCACCT to amplify part of the region upstream of the CEN1.1 gene. Oxidative bisulfite sequencing was performed as described in (Booth et al., 2013) to quantify levels of 5‐methylcytosine and subtracted from bisulfite sequencing data (which contains 5‐methylcytosine and 5‐hydroxymethylcytosine) to calculate levels of 5‐hydroxymethylcytosine; 10–20 clones were sequenced per sample. Sequencing data were analyzed using the online CYMATE tool (Hetzl, Foerster, Raidl, & Scheid, 2007) and the program SequenceFileConverter (J. Royle).