The largest database of trusted experimental protocols

Cell culture chamber

Manufactured by Corning
Sourced in United States

The cell culture chamber is a specialized equipment designed for the in vitro cultivation and maintenance of living cells. It provides a controlled and sterile environment to support the growth and proliferation of cells.

Automatically generated - may contain errors

6 protocols using cell culture chamber

1

Nanomedicine for Alzheimer's Disease Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chlorogenic acid (327‐97‐9) and ZnNO3 (10196‐18‐6) were purchased from Aladdin (Shanghai, China). DSPE‐PEG2000‐NH2 (R‐0038) was obtained from Xi'an Ruixi Biological Technology (China). Cell Counting Kit‐8 (CCK8) (K1018) was purchased from Apexbio (China). DAPI (C0060), Hoechst 33342 (C0031), RIPA lysis buffer (R0010), sheep erythrocyte hemolysin (H8360), 4% sheep red blood cell (SRBC) (S9045), guinea pig serum (complement) (S4990), and Albumin Bovine V(A8020) were purchased from Solarbio Life Science (China). The Calcein/PI Assay Kit (C2015S) and Lyso‐Tracker Red (C1046)/green (C1047S) fluorescent probe were purchased from Beyotime Biotechnology (China). Aβ1‐42 and FITC‐Aβ1‐42 were obtained from QYAOBIO (Shanghai, China). Dulbecco's modified Eagle's medium (DMEM), RPMI‐1640, and fetal bovine serum (FBS) were obtained from Procell (China). The cell culture chamber was purchased from Corning Incorporated (ME, USA). TfR aptamer (TfR‐A), Aβ aptamer (AAP), and CD22 shRNA plasmid (RNAi) were synthesized by Genechem Co., Ltd. Biotech (Shanghai, China).
Their sequences are as follows:
TfR‐A aptamer5″‐CGTAAATCAGTCAGAAGGCGTGGTACCACGCGCT/iFAMdT/TC‐3″
Aβ aptamer

5′ 6‐FAM1‐TGGGGGGCGGACGATAGGGGCCCCCCGGTAGGATGGAC

G‐3′ BHQ1

CD22 shRNA‐a

5′‐CCCGGGCAACAAACTACACCTGGTATCTCGAGATACCAGGTGTAGT

TTGTTGCTTTTTG‐3′

CD22 shRNA‐b

5′‐AATTCAAAAAGCAACAAACTACACCTGGTATCTCGAGATACCAGG

TGTAGTTTGTTGC‐3′

John Wiley & Sons, Ltd.
+ Open protocol
+ Expand
2

Cell Migration Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
During this assay, cells suspended with serum-free medium were seeded on the upper layer of a cell culture chamber (Corning, MA, USA) with permeable membrane and medium with 10% FBS was placed below the cell permeable membrane. Following 24 hrs incubation period, the cells that had migrated through the membrane were stained by 0.1% crystal violet, and then photographed and counted. All experiments were performed in triplicate.
+ Open protocol
+ Expand
3

Isolation and Characterization of Rat Bone Marrow Stromal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 1‐2 mL bone marrow samples were taken with a heparinized syringe from the lateral tibial tubercle of six newborn male SD rats (2‐weeks‐old). Low‐glucose DMEM (low‐DMEM) containing 10% foetal bovine serum (FBS) (Gibco) was used to wash the samples of bone marrow, we then centrifuged the samples at 200 g for 5 minutes, and the supernatants was discarded. Complete medium (Low‐DMEM mixture 10% FBS and 1% penicillin‐streptomycin) was also used to resuspend the cell pellets. BMSCs were isolated using density gradient centrifugation. Then we incubated the cells in a sterile flask (5 × 5 cm; Corning) at a cell culture chamber (37°C, 5% CO2). After 3 days of culture, the medium was replaced with new culture medium and the unattached cells were discarded. After the cell's reached satisfactory growth, then cells were washed with PBS, the cells were digested using trypsinase. Three lineage differentiations method was used to identify the BMSCs. Detailed on the specific method are in our previous study.25
+ Open protocol
+ Expand
4

Resveratrol Inhibits Cell Migration and Invasion

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell migration and invasion were detected by the Transwell method. Cells were collected with 0.25% trypsin-EDTA solution (Solarbio, China) and centrifuged. Cells were resuspended at a density of 5 × 105 cells/ mL in RPMI-1640 medium and treated with resveratrol at different concentrations (0, 12.5, 25, and 50 μM). Then, 100 μL of treated cells was inoculated into the upper compartment of the cell culture chamber (Corning, United States), and 700 μL of medium containing 10% FBS was added to the lower compartment for further culture for 24 h at 37 °C. After incubation, the cells on the upper surface of the membrane were removed. Cells below the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet ammonium oxalate solution. In the cell invasion assay, the Transwell chamber was coated with 1 mg/ mL Matrigel (Corning, United States) before the experiment, and the other steps were basically the same as in the migration assay. Cell migration and invasion were photographed with an inverted microscope.
+ Open protocol
+ Expand
5

Cell Migration and Invasion Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
To detect cell migration, we used cell culture chambers according to the manufacturer’s instructions (Corning Costar Corp., Cambridge, MA, USA), we first used trypsin digested cells and then collected cells with medium containing 10% FBS. Transfectant cells or control cells (5×104 cells) (approx. 250 mL) were transferred into the upper chamber, and the lower chamber was filled with 600 mL of medium containing 10% FBS. Then, the plate was placed in the incubator for 24 h. The membrane was fixed with 4% PFA and stained with 0.4% crystal violet solution for 20 min. Matrigel invasion performed using a procedure similar to that used for the migration assay. Cell migration and invasion ability were assessed by counting the cells that had migrated through the membrane. A total of five random fields of view were selected, and images were captured by a microscope at 20× magnification.
+ Open protocol
+ Expand
6

Cell Migration and Invasion Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
To detect cell capacity of migration and invasion, we used cell culture chambers according to the manufacturer's instructions (Corning Costar Corp., Cambridge, MA, USA). About 40 000/well of si‐NC or si‐COPB2 cells were transferred into the upper chamber and the lower chamber was filled with 600 mL of medium containing 20% FBS.
Then, the chamber was placed in the incubator in the above environment (37°C with 5% CO2). After 24 hours, the chamber was carefully removed and fixed with 4% paraformaldehyde and 0.4% crystal violet was used for staining the membrane in 15 minutes. Five random fields of view were selected for analysis and images were captured by a microscope at 20 × magnification.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!