Mini cycler

Total RNA isolated from F. solani was used as a template for first strand cDNA synthesis in a 20-μL reaction with M-MuLV reverse transcriptase (RT) and oligo (dT)₁₈ primer (5′-TTTTTTTTTTTTTTTTTT-3′) as the primer according to the manufacturer’s protocol. The reaction was stopped by heating the reaction mix at 70 °C for 10 min. PCRs were performed using T13αH specific primers T13αHF/T13αHR as 5′-AGATTGTCTCGGCGGCAAAAC-3′/5′-ATAGCTTTCTGGATGGGAGGCCA-3′, respectively and the DBAT specific primers DBAFTF1/DBATR1 as 5′-AGAGATTAAGCCCTCCTCGGA-3′/5′-CCTTCAATCCATGTTGCACGPCR-3′, respectively which had been designed using the conserved regions of the respective gene sequences reported at NCBI database. PCR conditions included an initial denaturation for 2 min followed by 35 cycles of denaturation for 94 °C for 45 s, annealing for 58.9/56 °C for T13αH/DBAT for 30 s and extension for 72 °C for 1 min, and a final extension for 10 min in a total volume of 50 μL containing 75 mM Tris–HCl (pH 8.8), 50 mM KCl, 5 mM MgCl₂ 2 mM of each dNTP, 20 pmol of each primer, 1 unit of Phusion polymerase (Thermo Fischer) and 2 µL of RT reaction product as a template on an MJ Research Mini Cycler (USA).

emm typing is based on sequence analysis of emm gene encoding for serotype specific M-protein. Genomic DNA was prepared by phenol-chloroform method [29 ] from bacteria obtained by touching the tips of β-hemolytic single colonies, obtained by subculture from overnight broth culture (BHI broth, Hi-media, Mumbai, India), to avoid contamination in growth in liquid medium. Bacterial cells were treated with mutanolysin and lysozyme solution for 1 h at 37 °C. For emm typing analysis, gene was amplified by “all M” primers [15 (link), 30 (link)], using PTC150 (MiniCycler^TM, MJ Research) thermal cycler. PCR amplicon of about 1.4 kb was then sequenced with the forward primer (5′ ATAAGGAGCATAAAAATGGCT 3′). Sequencing was done commercially (Chromous Biotech Pvt. Ltd., India). The sequence was subjected to homology search by Blast search analysis (http://www.cdc.gov/ncidod/biotech/strep/ strepblast.htm). Pair-wise comparison of the nucleotide identities of the first 180 to 200 bases of the N-terminal hypervariable region was conducted and strains which showed ≥ 95% homology with the reference strains were assigned the particular parental emm type [15 (link)].

The DNA amplification performed in this study was a replication of the method reported in Radjasa et al. [23 ]. The primers used were as follows: Forward: 5’-AGAGTTTGATCMTGGCTCAG-3’, positions 8-27 and 1500; reverse: 5’-GGTTACCTTGTTACGACTT-3’, positions 1510–1492 based on the sequence of the 16S rRNA from E. coli [24 ]. The PCR DNA amplification method was carried out on a thermal cycler (Mini cycler TM, MJ Research Inc., Watertown, MA, USA) with the following temperature conditions: Initial denaturation at 94°C for 2 min; followed by 30 cycles of denaturation at 94°C for 2 min, annealing at 45°C for 2 min, and extension at 72°C for 2 min; and a final extension at 72°C or 3 min. Electrophoresis was carried out by inserting 1 μL of the PCR product aliquot into a well that was filled with 1% agarose gel. The preparations were then placed in 50× TAE buffer and observed to determine whether the DNA amplification was satisfactory. The products of PCR amplification were purified and concentrated using a Microcon-100 microconcentrator (Amicon, Beverly, MA, USA) according to the OEM manual. Finally, 16S rDNA gene sequences were determined using the SequiTherm Long-Read Sequencing Kit (Epicenter Technologies, Madison, WI, USA).