Reverse transcriptase

Approximately 10⁷ cells were harvested from culture plates using trypsin. Total RNA, including mRNAs and miRs, was purified using Qiagen RNAeasy Columns (Qiagen, Hamburg, Germany) according to the manufacturer's protocols. For the miR assay, the cDNA of each miR was synthesized with a unique primer (Applied Biosystems) by using 20 ng of total RNA. For the mRNA quantitative assay, cDNAs were synthesized from 1 μg of total RNA with random hexamer primers by using Reverse Transcriptase (Applied Biosystems).

Mouse tissues were lysed in Trizol reagent (Thermo Fisher Scientific) using the TissueLyser (Qiagen) and total RNA was purified using the RNeasy mini kit including DNase I digestion (Qiagen) according to manufacturer’s instructions. Total RNA from cultured cells was isolated directly using the RNeasy mini kit. Following conversion of RNA to cDNA with reverse transcriptase (Applied Biosystems), SYBR Green-based quantitative real-time PCR analysis (Roche Applied Science) was performed with the 7500 fast Real-Time PCR System (Thermo Fisher Scientific). All quantitative PCR primers are listed in Table S3.
Tissue and cell lysates in RIPA buffer were used for Western blotting with the following antibodies: anti-p110γ (Cat#5405, 1:1000, Cell Signaling Technology), anti-p110α (Cat#4255, 1:1000, Cell Signaling Technology), and anti-β-actin (Cat#612656, 1:3000, BD Biosciences).

Total RNA isolated from kidney tissues by TRIzol reagent (Invitrogen) was reverse-transcribed to cDNA using reverse-transcriptase (Applied Biosystems). PCR reactions were carried out with 0.08 μM of each forward and reverse primer, cDNA, water and 2X SYBR Green master mix (Applied Biosystems) in a final volume of 20 μl. Amplification was performed in a StepOne Plus real-time PCR machine (Applied Biosystems). Mouse β actin was used as an internal control and the relative mRNA expression was calculated using 2^−ΔΔCt method. The following list of primer sequences were used: TNF-α, 5’-AGACCCTCACACTCAGATCATCTTC-3’ (forward), and 5’- TTGCTACGACGTGGGCTACA-3’ (reverse); IL-6, 5’-CCGGAGAGGAGACTTCACAG-3’ (forward) and 5’- CAGAATTGCCATTGCACAAC-3’ (reverse); IL-1β, 5’-CAGGATGAGGACATGAGCACC-3’ (forward), and 5’-CTCGCAGACTCAAACTCCAC- 3’ (reverse); KIM-1, 5’ TGCTGCTACTGCTCCTTGTG 3’ (forward), and 5’ GGGCCACTGGTACTCATTCT 3’ (reverse); IL-18, 5’ GCCTCAAACCTTCCAAATCA 3’ (forward) and 5’ TACAGTGAAGTCGGCCAAAG3’ (reverse); β-actin, 5’-CGTGAAAAGATGACCCAGATCA-3’ (forward), and 3’-TGGTACGACCAGAGGCATACAG-3’ (reverse).

Total RNA was isolated from DS1, DS2, DS3 regions cells and quantified using a Nanodrop 2000 spectrophotometer. Conversion of cDNA was performed on 200 ng of RNA using reverse transcriptase (Applied Biosystems). Primer sequences, annealing temperature and product size of RT-PCR analysis are summarized in Table 1. GAPDH was used as the house keeping internal control. The products were resolved in 2% agarose gel electrophoresis. The band intensity was quantified and plotted the graph. Cells treated with Phorbol 12-myristate 13-acetate (PMA) (15 ng/mL concentration) was used as control for the expression of inflammatory markers.

EstRASF were cultured in the presence of 0.5, 1 and 2 μM 5-Azacytidine (5-AzaC) for 6 days. Then, total RNA was extracted with Miniprep kit (Qiagen) and reverse transcribed to cDNA with reverse transcriptase (Applied Biosystems). Quantitative PCR reaction was performed with SYBR green (Roche) on Taqman 7500 Real-time PCR system (Applied Biosystems). Exon spanning specific primers for DNMT1 FW 5′TAACAGAAAAGGAATGTGTGAAGG3′ REV 5′TATTTCTGTTTGCAGAAATTCGTGC3′ and TET1 FW 5′TGCACCCTCAATGAAAATCGT3′- REV 5′GGGCTTGGGCTTCTACCAAA3′ were used. Cycle thresholds (Ct) were normalized to the housekeeping gene RPLO.