Bullet blender

Manufactured by Next Advance

Sourced in United States, Canada, Germany, United Kingdom

The Bullet Blender is a high-speed blending device designed for efficient homogenization and disruption of samples. It utilizes a spinning impeller blade to mix, grind, and pulverize materials within a sealed container.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Bullet Blender 24 (20 citations) Bullet BlenderTM 24 mixer mill (2 citations) Bullet Blender Gold Cell Disrupter (2 citations) Bullet Blender Storm 24 (38 citations) Bullet Blender Strom 24 (2 citations) Bullet Blender 5 (4 citations) Bullet Blender Strom 24 blender (2 citations) Bullet Blender Storm BBX24 (2 citations) Bullet Blender 5 homogenizer (2 citations) Bullet Blender 24 Homogenizer (5 citations)

511 protocols using bullet blender

Haem quantification in mouse tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were perfused with PBS under anaesthesia. Harvested organs (300 mg) were homogenized in radio-immunoprecipitate assay buffer using the Next Advance Bullet Blender (Next Advance, Inc.). Homogenized samples were centrifuged at 18 800 g for 10 min to obtain clear lysates. All tissue processing was carried out at 4°C. Total haem in tissue lysates was quantified using a colourimetric assay kit (QuantiChrom haem assay kit; Bioassay Systems, Hayward, CA, USA) as described in previous studies (Ghosh et al, 2018 (link)). The bicinchoninic acid (BCA) assay kit (ThermoFisher Scientific, Catalogue number 23225) was used to quantify total protein in the lysates. Total haem values were first normalized to total protein, and then the haem values from vehicle-injected control organs were subtracted from the corresponding haem-injected organ values to determine the increase in haem in each organ after haemin injection.

Gbotosho O.T., Ghosh S., Kapetanaki M.G., Lin Y., Weidert F., Bullock G.C., Ofori-Acquah S.F, & Kato G.J. (2019). Cardiac expression of HMOX1 and PGF in sickle cell mice and haem-treated wild type mice dominates organ expression profiles via Nrf2 (Nfe2l2). British journal of haematology, 187(5), 666-675.

+ Open protocol

+ Expand

Standardized Viral RNA Extraction Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ribonucleic acid (RNA) extraction and PCR testing were performed at the Sunnybrook Research Institute in Toronto, Ontario. All swab, tissue and guano samples were stored at -80°C prior to testing. For oral, rectal or nasal swab samples, RNA extractions were performed using 140 µL of sample via the QIAmp viral RNA mini kit (Qiagen, Mississauga, Ontario) or the Nuclisens EasyMag using Generic Protocol 2.0.1 (bioMérieux Canada Inc., St-Laurent, Québec) according to manufacturer’s instructions. The RNA from guano samples (80 mg) were extracted via the QIAmp viral RNA mini kit and eluted in 40 µL in containment level 3 at the University of Toronto. Tissue samples were thawed, weighed, minced with a scalpel, and homogenized in 600 µL of lysis buffer using the Next Advance Bullet Blender (Next Advance, Troy, New York, US) and a 5 mm stainless steel bead at 5 m/s for 3 minutes. The RNA from 30 mg tissue samples was extracted via the RNeasy Plus Mini kit (Qiagen, Mississauga, Ontario) or the Nuclisens EasyMag using Specific Protocol B 2.0.1; RNA was eluted in 50 µL. All extractions were performed with a positive and negative control. Extraction efficiency between kits was assessed through comparison of positive extraction controls.

Greenhorn J.E., Kotwa J.D., Bowman J., Bruce L., Buchanan T., Buck P.A., Davy C.M., Dibernardo A., Flockhart L., Gagnier M., Hou A., Jardine C.M., Lair S., Lindsay L.R., Massé A., Muchaal P.K., Nituch L.A., Sotto A., Stevens B., Yip L, & Mubareka S. (2022). SARS-CoV-2 wildlife surveillance in Ontario and Québec. Canada Communicable Disease Report, 48(6), 243-251.

+ Open protocol

+ Expand

Proteomic Analysis of Frozen Tongue SCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen human tongue SCC tissue with adjacent normal tissue samples were obtained from the MUSC Hollings Cancer Center (HCC) Biorepository & Tissue Analysis Shared Resource. The study was approved by the ethics committee of the MUSC Institutional Review Board. Patients’ identities associated with all the tissue samples were removed prior to analyses. After procurement of the tissues, the samples were homogenized with stainless steel blend beads (Next Advance, Averill Park, NY) in lysis buffer containing 100 mM Tris-HCl, pH 7.4, 2% SDS, and 1× protease inhibitor cocktail (Thermo Fisher Scientific) using a Next Advance Bullet Blender^®, according to the manufacturer’s instructions. Afterwards, 10 μg of protein extracts were used for Western blot analysis.

Cantini L.P., Andino L.M., Attaway C.C., Butler B., Dumitriu A., Blackshaw A, & Jakymiw A. (2014). Identification and characterization of Dicer1e, a Dicer1 protein variant, in oral cancer cells. Molecular Cancer, 13, 190.

+ Open protocol

+ Expand

Quantifying Heart IL-6 in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were perfused with phosphate-buffered saline under anesthesia. Harvested organs (300 mg) were homogenized in RIPA buffer using the Next Advance Bullet Blender (Next Advance, Inc. Troy, NY). Homogenized samples were centrifuged at 18,800 x g for 10 min to obtain clear lysates. All tissue processing was carried out at 4°C. Heart IL-6 concentration was measured using the mouse IL-6 ELISA kit (Sigma-Aldrich) following the manufacturer's instructions. Total protein was quantified in the lysates using the BCA assay kit (ThermoFisher Scientific, #23225).

Gbotosho O.T., Kapetanaki M.G., Ghosh S., Villanueva F.S., Ofori-Acquah S.F, & Kato G.J. (2020). Heme Induces IL-6 and Cardiac Hypertrophy Genes Transcripts in Sickle Cell Mice. Frontiers in Immunology, 11, 1910.

+ Open protocol

+ Expand

Quantification of Murine Astrovirus in Feces and Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Inoculum was prepared using homogenized feces (100 mg/ml in PBS) using a Next Advance Bullet Blender (Next Advance, Inc. Troy, NY, USA) (4 min, level 4) before the samples were centrifuged at 14,000 rpm for 2 minutes and then 0.22 μm-filtered. To quantitate virus levels, RNA was extracted using the MagMAX-96 AI/ND Viral RNA Isolation Kit (Thermo Fisher, Waltham, MA, USA) for fecal filtrates (100 mg/ml in PBS, 50 μl) or the MagMAX Pathogen RNA/DNA Kit (Thermo Fisher) for tissue homogenate (1 mg/ml in PBS, 300 μl) using the KingFisher Flex Purification System (Thermo Fisher Scientific, Waltham, MA, USA). Copies of the MuAstV genome were quantified using a g-block standard (Integrated DNA Technologies) in a one-step quantitative RT-PCR using TaqMan Fast Advanced Master Mix Virus (Applied Biosystems, Waltham, MA, USA) with primers (F: TACATCGAGCGGGTGGTCGC, R: GTGTCACTAACGCGCACCTTTTCA) and probe ((6-FAM)-TTTGGCATGTGGGTTAA-(MB GNFQ)^{2 (link)} under the following conditions: 50 °C for 5 minutes, 95 °C for 20 seconds followed by 40 cycles of 95 °C for 3 seconds and 60 °C for 30 seconds on a BioRad CFX96 Real-Time System (BioRad, Hercules, CA, USA)^{5 (link).}

Yang T., Snider B.B, & Oprian D.D. (1997). Synthesis and characterization of a novel retinylamine analog inhibitor of constitutively active rhodopsin mutants found in patients with autosomal dominant retinitis pigmentosa. Proceedings of the National Academy of Sciences of the United States of America, 94(25), 13559-13564.

+ Open protocol

+ Expand

Quantitative RNA Analysis of Larval Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four biological replicate total RNA samples were prepared per sample group using 8 larvae per sample. Each set of larvae for a given sample was homogenized using a Next Advance Bullet Blender (Next Advance, Troy, NY, USA) with a single 5 mm sterile, stainless steel metal bead in 360 μL of Trizol (Invitrogen, Waltham, MA, USA) for 3 min. Homogenates were centrifuged for 3 min at 8000× g and transferred to new tubes. Total RNA was extracted using the Direct-zol RNA microprep kit (Zymo Research, Irvine, CA, USA) following the manufacturer’s protocol. cDNA was synthesized using the ProtoScript II First Strand cDNA synthesis kit (New England Biolabs, Ipswich, MA, USA), following the manufacturer’s protocol. qRT-PCR assays were conducted using Bio-Rad SsoAdvance Universal SYBR Green Mastermix (Bio-Rad, Hercules, CA, USA), and oligos (IDT, Coralville, IA, USA), shown in Table S1, and a Bio-Rad CFX96 instrument (Bio-Rad) according to the manufacturer’s protocol.

Soos B.L., Ballinger A., Weinstein M., Foreman H., Grampone J., Weafer S., Aylesworth C, & King B.L. (2024). Color-Flu Fluorescent Reporter Influenza A Viruses Allow for In Vivo Studies of Innate Immune Function in Zebrafish. Viruses, 16(1), 155.

+ Open protocol

+ Expand

Cytokine Quantification in Serum and Skin

Check if the same lab product or an alternative is used in the 5 most similar protocols

For measuring cytokine levels in serum, the collected serum was stored at −80 °C until analysis. Subsequently, skin samples were homogenized using a Bullet Blender^TM (Next Advance, Averill Park, NY, USA) at 4 °C, and the supernatants were stored at −80 °C. Serum and skin IL-17A, IL-22, IL-23, and TNF-α levels were measured using specific enzyme-linked immunosorbent assay kits for IL-17A (R&D system, Minneapolis, MN, USA), IL-22 (eBioscience, San Diego, CA, USA), IL-23 (eBioscience, San Diego, CA, USA), and TNF-α (eBioscience, San Diego, CA, USA). The protocols followed were provided by the manufacturer.

Chen H.H., Lin C.C., Tung Y.T., Chao Y.H., Huang W.C, & Lee P.Y. (2020). Combination Therapy of Acarbose and Cyclosporine a Ameliorates Imiquimod-Induced Psoriasis-Like Dermatitis in Mice. Molecules, 25(8), 1822.

+ Open protocol

+ Expand

Protein Extraction and Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare cell lysates, cells treated with either DMSO or drugs in the complete growth medium were washed in cold PBS and lysed in lysis buffer (Thermo Scientific) containing protease inhibitor and phosphatase inhibitor (Thermo Scientific). To prepare tumor lysates, tumor tissues were homogenized in lysis buffer with a Bullet BlenderTM (Next Advance) following the manufacturer’s instructions. The lysate samples were centrifuged at 13000 rpm and the supernatants were transferred to a new tube and protein concentration was determined using BCA protein assay reagent (Thermo Scientific). Equal amounts of protein from each lysate were separated by electrophoresis on SDS gels, transferred to PVDF (Polyvinylidene Fluoride) membranes and incubated with total and phosphorylated antibodies. Binding of the primary antibody was detected using a horseradish peroxidase (HRP)-conjugated secondary antibody and chemiluminescent substrate (Thermo Scientific).

Wen W., Liang W., Wu J., Kowolik C.M., Buettner R., Scuto A., Hsieh M.Y., Hong H., Brown C.E., Forman S.J., Horne D., Morgan R., Wakabayashi M., Dellinger T.H., Han E.S., Yim J.H, & Jove R. (2014). Targeting JAK1/STAT3 signaling suppresses tumor progression and metastasis in a peritoneal model of human ovarian cancer. Molecular cancer therapeutics, 13(12), 3037-3048.

+ Open protocol

+ Expand

Muscle Homogenization for Oxidative Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quadriceps thigh muscles were taken from both hind limbs, and the muscles were cleaned of fat and connective tissue. The muscles thus isolated were placed in tubes, which were then frozen in liquid nitrogen and stored at −80°C until further procedures. The muscles were homogenized in a Bullet BlenderTM (Next Advance, 4116-BBY24M-CE). Muscle tissue was cut into pieces, weighing about 100 mg, and placed in a microcentrifuge tube. Zirconium silicate beads (0.5 mm; Next Advance Inc., ZROB05) of 300 mg were added to the tube. Then, 0.2 ml of the homogenization buffer (T-PER Tissue Protein Extraction Reagent; Thermo Scientific 78,510) was added. The tube was sealed and placed in a Bullet BlenderTM, the speed was set to 9, while the time was set to 3 min. The homogenate was used for the determination of reactive oxygen species and CK levels.

Pierzynowska K., Podlacha M., Gaffke L., Rintz E., Wiśniewska K., Cyske Z, & Węgrzyn G. (2023). Correction of symptoms of Huntington disease by genistein through FOXO3-mediated autophagy stimulation. Autophagy, 20(5), 1159-1182.

+ Open protocol

+ Expand

RNA Extraction from Tissue Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from individual samples by using Absolutely RNA Miniprep Kit (Agilent Technologies). Briefly, the tissues were mixed with 1mm RNAse free glass beads, Lysis Buffer and β-mercaptoethanol and homogenized using a Bullet blender (Next advance, USA). The homogenate was spun through a pre-filter spin cup in a Heraesus Fresco 21 centrifuge at maximum speed at RT, before mixed with 70% ethanol in a 1:1 ratio (Solveco) for RNA precipitation. The solution was centrifuged through a RNA binding spin cup. The filter was washed in salt buffers and RNase-Free DNase 1 and allowed to incubate for 15min at 37°C. Additional salt buffer washes were performed prior to RNA elution. Concentration was measured using a ND-1000 spectrophotometer (NanoDrop Technologies).

Perland E., Lekholm E., Eriksson M.M., Bagchi S., Arapi V, & Fredriksson R. (2016). The Putative SLC Transporters Mfsd5 and Mfsd11 Are Abundantly Expressed in the Mouse Brain and Have a Potential Role in Energy Homeostasis. PLoS ONE, 11(6), e0156912.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!