Primers were designed and synthesized by Tsingke Biotechnology Co., Ltd. (Shanghai, China). Primer sequences are listed in Table S2 . Total RNA was isolated from the femoral head tissues using TRIzol (Invitrogen, Waltham, MA) following the manufacturer's protocol. First‐strand cDNA synthesis was performed using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA). qRT‐PCR was performed in an ABI 7300 Real‐Time PCR system (Applied Biosystems, CA) using FastStart Universal SYBR Green Master kit (ROX; Roche, Toronto, Canada). mRNA levels were calculated using the 2−ΔΔCt method and normalized to GAPDH expression.
Faststart universal sybr green master rox kit
Manufactured by Roche
Sourced in Germany, Switzerland, United States, China
The FastStart Universal SYBR Green Master (ROX) kit is a ready-to-use solution for real-time PCR analysis using SYBR Green I dye and ROX passive reference dye. The kit includes all the necessary components for amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (15 mentions)
Trizol reagent, by Thermo Fisher Scientific (13 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (7 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (3 mentions)
Mastercycler 5333, by Eppendorf (3 mentions)
Improm 2 reverse transcription system, by Promega (3 mentions)
Bca kit, by Thermo Fisher Scientific (3 mentions)
Lightcycler 480 2 real time pcr system, by Roche (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Rnaprep pure tissue kit, by Tiangen Biotech (2 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
74 protocols using faststart universal sybr green master rox kit
1
Quantitative RT-PCR of Femoral Head
2
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT PCR (qRT-PCR) was performed using FastStart Universal SYBR Green Master Kit (ROX, Roche Applied Science, Mannheim, Germany) and a LightCycler 480II RealTime PCR System (Roche). The CT method was used to measure PCR amplification fold differences. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the expression level of each gene. All primers were synthesized at Beijing Invitrogen, China. Primer sequences were: E-cadherin (sense) 5′-TTCCTCCCAATACATCTCCC-3′ and (antisense) 5′-TTGATTTTGTAGTCACCCACC-3′; vimentin (sense) 5′-CTCTTCCAAACTTTTCCTCCC -3′ and (antisense) 5′-AGTTTCGTTGATAACCTGTCC-3′; Snail 1 (sense) 5′-TAGCGAGTGGTTCTTCTGC-3′ and (antisense) 5′-GCTGGAAGGTAAACTCTGG-3′; Snail 2 (sense) 5′-CTCCAAAAAGCCAAACTACAG-3′ and (antisense) 5′-GAGAGAGGCCATTGGGTAG-3′; and GAPDH (sense) 5′-GAAGGTGAAGGTCGGAGT-3′ and (antisense) 5′- GAGATGGTGATGGGATTTC-3′.
3
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, total RNA from cultured cells or EOC tissue samples was extracted using TRIzol (Life Technologies) according to the manufacturer's instructions.
Reverse transcription (RT) of total mRNA was performed using a PrimeScript RT Reagent kit (TaKaRa). cDNAs were amplified and quantified in Bio-Rad CFX qRT- PCR detection system (Applied Biosystems Inc., Foster City, CA, USA) via using FastStart Universal SYBR Green Master kit (ROX; Roche, Toronto, ON, Canada) and quantified by using the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). The expression data were normalized to housekeeping gene GAPDH to control the variability in expression levels and calculated as 2−[(Ct of gene) – (C t of GAPDH)], where Ct represents the threshold cycle for each transcript. The primer sequences were obtained from the Genome database was shown in Primers and Oligonucleotides table in Supplementary Table S3.
Reverse transcription (RT) of total mRNA was performed using a PrimeScript RT Reagent kit (TaKaRa). cDNAs were amplified and quantified in Bio-Rad CFX qRT- PCR detection system (Applied Biosystems Inc., Foster City, CA, USA) via using FastStart Universal SYBR Green Master kit (ROX; Roche, Toronto, ON, Canada) and quantified by using the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). The expression data were normalized to housekeeping gene GAPDH to control the variability in expression levels and calculated as 2−[(Ct of gene) – (C t of GAPDH)], where Ct represents the threshold cycle for each transcript. The primer sequences were obtained from the Genome database was shown in Primers and Oligonucleotides table in Supplementary Table S3.
4
Quantification of c-MYC Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were treated with 2 μM tetrandrine or DMSO for 24 h. Total RNA was isolated using the Total RNA Kit I (Omega Bio-Tek, Inc., GA). Then, RNA was transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Science, USA) according to the manufacturer’s instructions. qRT–PCR was performed using the FastStart Universal SYBR Green Master kit (Rox) (Roche Life Science, USA) on the Applied Biosystems 7500 Fast Real-Time PCR System (PerkinElmer, Torrance, CA). The following primer pairs were used for qRT–PCR: c-MYC: forward, 5′-CACCGAGTCGTAGTCGAGGT-3′ and reverse, 5′-TTTCGGGTAGTGGAAAACCA-3′. GAPDH: forward, 5′-TCCACCACCCTGTTGCTGTA-3′ and reverse 5′-ACCACAGTCCATGCCATCAC-3′. All reactions were performed in triplicate in a 20-μl reaction volume. Fold changes in gene expression were determined using the 2−ΔΔCt method with GAPDH as an endogenous control.
5
Measuring miR-21-5p and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of miR-21-5p was detected using a TaqMan MicroRNA Assay System and TaqMan MicroRNA Reverse Transcription Kit (ABI) in a DNA Engine Peltier Thermal Cycler (Bio-Rad) following the manufacturer's instructions. Quantitative PCR was performed using the TaqMan Universal Master Mix II (ABI) in a LightCycler 480 II Real-Time PCR System (Roche, Rotkreuz, Switzerland). U6 expression was used to normalize miR-21-5p expression. Each experiment was performed in triplicate.
qRT-PCR of mRNAs was performed using a FastStart Universal SYBR Green Master Kit (ROX) (Roche Applied Science, Mannheim, Germany) and LightCycler 480 II Real-Time PCR System (Roche) according to the manufacturer's instructions. The comparative threshold cycle method was used to measure fold-differences in PCR amplification. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression was measured to normalize the expression of each gene. All primers were synthesized at Invitrogen's (Beijing, China) core facility. The primer sequences used (5′-3′) were as follows: PTEN sense: GGACGAACTGGTGTAATG, antisense: GCCTCTGAC TGGGAATAG; PDCD4 sense: AGGCTGAGGCAGGA GAAT, antisense: TCCCACCAGTAATGACAAAA; GAPDH sense: GAAGGTGAAGGTCGGAGT, antisense: GAGATGGTGATGGGATTTC.
qRT-PCR of mRNAs was performed using a FastStart Universal SYBR Green Master Kit (ROX) (Roche Applied Science, Mannheim, Germany) and LightCycler 480 II Real-Time PCR System (Roche) according to the manufacturer's instructions. The comparative threshold cycle method was used to measure fold-differences in PCR amplification. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression was measured to normalize the expression of each gene. All primers were synthesized at Invitrogen's (Beijing, China) core facility. The primer sequences used (5′-3′) were as follows: PTEN sense: GGACGAACTGGTGTAATG, antisense: GCCTCTGAC TGGGAATAG; PDCD4 sense: AGGCTGAGGCAGGA GAAT, antisense: TCCCACCAGTAATGACAAAA; GAPDH sense: GAAGGTGAAGGTCGGAGT, antisense: GAGATGGTGATGGGATTTC.
6
Linarin Extract from Flos Chrysanthemi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Linarin extract was processed from Flos Chrysanthemi (Zhejiang Chinese Medical University, Traditional Chinese Medicine Decoction Pieces, Ltd). The amount of linarin was determined by HPLC analysis as described in our previous protocol [19 (link)]. The linarin content in the extract is 72%. HFHC diet (10% fat, 1% cholesterol, 0.2% cholate) were prepared by TROPHIC Animal Feed High Tech Co. (Nantong, China). Kits for serum biochemistry analysis including cholesterol (TC), triglyceride (TG), high density lipoprotein-cholesterol, (HDL-c), low density lipoprotein-cholesterol (LDL-c), glucose and alanine transaminases (ALT), and aspartate transaminases (AST) were purchased from MeiKang Chemical Co. (Ningbo, China). Liver TC and TG quantification kits were from Applygen Technologies Inc. (Beijing, China). Both First-strand cDNA synthesis kit and FastStart Universal SYBR Green Master (ROX) kit were products from Roche (USA). BCA kit for protein quantification was from Beyotime Biotechnology (Shanghai, China). Phospho-SAPK/JNK (Thr183/Tyr185) and SAPK/JNK primary antibody were purchased from Cell Signaling Technology (USA).
7
Cytochrome P450 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dulbecco's modified Eagle's medium (DMEM, high glucose) and 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) were obtained from Sigma-Aldrich Co. (St. Louis, USA). UNIQ-10 column Trizol total RNA extraction kit, anti-GAPDH, and anti-CYP3A4 antibody were obtained from Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). Anti-CYP2D6 and HRP-conjugated goat anti-rabbit IgG antibody were bought from Abgent (San Diego, USA). FastStart Universal SYBR Green Master (ROX) kit was purchased from Roche (Mannheim, Germany). P450-Glo Assay kits were purchased from Promega (Madison, WI, USA).
8
MG-63 Cell Line Characterization and p53 Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human osteosarcoma cell line, MG-63, was purchased from the Institute of Basic Medical Sciences of the Chinese Academy of Medical Sciences (Beijing, China); plasmids were constructed at the early stage of this project by the team members; Lipofectamine® 2000 was from Invitrogen; Thermo Fisher Scientific, Inc. (Waltham, MA, USA); MTT and RIPA lysis buffer both from Beijing PPLYGEN Technology Co., Ltd. (cat. no. C1053; Beijing, China); TRIzol kit was from Invitrogen; Thermo Fisher Scientific, Inc. (cat. no. 15596026); TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit both from TransGen Biotech Co., Ltd. (cat. no. AT311-02; Beijing, China); FastStart Universal SYBR-Green Master (Rox) kit was from Roche Diagnostics (cat. no 04913914001; Indianapolis, IN, USA); BCA kit was from Thermo Labsystems (cat. no 23225; Santa Rosa, CA, USA); Cell cycle assay kit for flow cytometry was from Baomanbio Co., Ltd. (cat. no. GMS10021.1; Shanghai, China).
Mouse monoclonal wild-type p53 antibody (dilution, 1:500; cat. no. 178924), mouse monoclonal mutant p53 antibody (dilution, 1:500; cat. no. 178379) and HRP-labeled goat anti-mouse secondary antibody (dilution, 1:2,000; cat. no. 197302) were from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China).
Mouse monoclonal wild-type p53 antibody (dilution, 1:500; cat. no. 178924), mouse monoclonal mutant p53 antibody (dilution, 1:500; cat. no. 178379) and HRP-labeled goat anti-mouse secondary antibody (dilution, 1:2,000; cat. no. 197302) were from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China).
9
RNA Extraction and qPCR Analysis of ALOXE3 and ALOX12
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We collected and stored the tissues in the RNA protection solution and stored it in a −80°C refrigerator, then lysed the tissue with TRIzol® reagent (Invitrogen) to extract total RNA. The RNA was reverse-transcribed into cDNA (20 uL) using a reverse transcription kit (Applied Biosystems by Thermo Fisher Scientific, USA), and finally, the cDNA was mixed with the FastStart Universal SYBR Green Master (ROX) kit (Roche) to perform qPCR which worked according to the guide of Applied Biosystems QuantsudioTM Real-Time PCR System (Q6) (Applied Biosystems by Thermo Fisher Scientific). The reaction conditions were: pre-heating at 95°C for 10 min; repeating 40 cycles at 95°C for 15 seconds, 60°C for one minute and 95°C for 30 seconds; in the end, denaturation at 95°C for 15 seconds, 60°C for one minute, 95°C for 30 seconds, 60°C for 15 seconds. The primers (designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd, China) we used as followed: GAPDH (upstream: 5ʹ-TGGTCCCTGCTCCTCTAAC-3ʹ; downstream: 5ʹ-GGCTCAATGGCGTACTCTC-3ʹ), ALOXE3 (upstream: 5ʹ-CAAGGACTCTTGGTACTGTAGC-3ʹ; downstream: 5ʹ-TAGCCTTCAATCCACTGATAGC-3ʹ) and ALOX12 (upstream: 5ʹ-GATCCGAGGAGAGAAGCAATAC-3ʹ; downstream: 5ʹ-TGAGTGTTCAGCAAGTGATACT-3ʹ). The relative expression of ALOXE3 and ALOX12 we performed was used the method of 2‑ ∆∆ Cq.42 (link)
10
Quantitative RT-PCR Analysis of RBP4 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Commercial reagents (miRNeasy; QIAGEN) were used to isolate purified mRNA, and cDNA was immediately generated by Transcriptor First-Strand cDNA Synthesis Kit (Roche). For quantitative RT-PCR, RBP4 transcripts were amplified using primers 5′-GACAAGGCTCGTTTCTCTGG-3′ and 5′-AAAGGAGGCTACACCCCAGT-3′ (University of Utah Genomics Core) and detected with the FastStart Universal SYBR Green Master (Rox) kit (Roche) on a 7900HT Fast Real-Time PCR System (Applied Biosystems).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!