Pcr master mix

Manufactured by Arraystar

Sourced in United States

2 × PCR Master Mix is a ready-to-use solution for performing polymerase chain reaction (PCR) amplification. It contains all the necessary components, including DNA polymerase, nucleotides, and buffer, in a concentrated format to simplify PCR setup and improve consistency.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green PCR Master Mix (8 citations) SYBR Green Real-time PCR Master Mix (2 citations)

63 protocols using pcr master mix

Validating tRF and tiRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The small RNA sequencing results were validated by RT-qPCR. To assess the expression of tsRNAs, RNA pre-treatment was performed by using the rtStar™ tRF and tiRNA pre-treatment kit (Arraystar, Rockville, MD, USA); then, the samples were transcribed into cDNA utilizing rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor) (Arraystar). RT-qPCR was performed using 2 × PCR Master Mix (Arraystar) on the QuantStudio™ 5 real-time PCR system (Applied Biosystems, Foster City, CA, USA).
To evaluate miRNA expression levels, RNA was transcribed into cDNA using M-MuLV reverse transcriptase (Enzymatics, Beverly, MA, USA) as directed by the manufacturer with the Gene Amp PCR system 9700 (Applied Biosystems). RT-qPCR was performed using the ViiA 7 real-time PCR system (Applied Biosystems) with 2 × PCR Master Mix (Arraystar).
The reaction conditions of the 2 experiments were as follows: incubation at 95°C for 10 min, incubation at 95°C for 10 s, and incubation at 60°C for 60 s, with 40 cycles. Expression levels were calculated with a 2−ΔΔCt method (18 (link)) and normalized with U6. Primer sequences are shown in Tables 1, 2.

Yang Y., Yue W., Wang N., Wang Z., Li B., Zeng J., Yoshida S., Ding C, & Zhou Y. (2022). Altered Expressions of Transfer RNA-Derived Small RNAs and microRNAs in the Vitreous Humor of Proliferative Diabetic Retinopathy. Frontiers in Endocrinology, 13, 913370.

+ Open protocol

+ Expand

Profiling tRNA-derived Fragments in Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Six of the high different degrees and the qualified requirements for signal values were selected. Total RNA was extracted from 16 clinical samples with TRIZOL (Invitrogen life technologies). cDNA was synthesized with the rtStar™ First-Strand cDNA Synthesis Kit (3’ and 5’ adaptor) (Cat# AS-FS-003, Arraystar, MD, USA). The primers were designed for the tRNA-derived fragments particularly by Primer 5.0 and were synthesized with 2X PCR master mix (Arraystar, MD, USA). U6 was utilized as an internal control. Quantitative Real-time PCR was performed on ViiA 7 Real-time PCR System (Applied Biosystems, MA, USA). The relative expression level of each tRNA-derived fragments was calculated with the 2-△Ct method.

Wang X., Yang Y., Tan X., Mao X., Wei D., Yao Y., Jiang P., Mo D., Wang T, & Yan F. (2019). Identification of tRNA-Derived Fragments Expression Profile in Breast Cancer Tissues. Current Genomics, 20(3), 199-213.

+ Open protocol

+ Expand

AIP Biomarker Validation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

In the present study, original validation (samples were divided into invasive group and control group, and all sample were collected from 5 patients with AIP) and extended validation (samples were divided into AIP group and normal group. Samples of AIP group were collected from 15 patients with AIP, samples of the normal group were collected from 15 patients without AIP) was conducted to validate the results of microarray through RT-qPCR. For RT-qPCR validation, total RNA was extracted with TRIzol reagent from the remaining portion of tissues not used in the lncRNA microarray. Subsequently, first-strand complementary DNAs were generated using SuperScript^™ III Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The RT-qPCR process was performed using a ViiA-7 RT-PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) and 2X PCR master mix (Arraystar, Inc.). The relative expression levels of lncRNAs were quantified using the 2^-ΔΔCq method (16 (link)) and were normalized to β-actin expression. The primers for RT-qPCR were designed according to the lncRNA sequences in NONCODE (http://www.noncode.org) and primer sequences were synthesized and purified by Yingjun Co. The primer sequences are listed in Table SI.

Zhang H., Wu S., Ye S., Ma H, & Liu Z. (2020). Preliminary RNA-microarray analysis of long non-coding RNA expression in abnormally invasive placenta. Experimental and Therapeutic Medicine, 21(1), 13.

+ Open protocol

+ Expand

Verification of Differentially Expressed lncRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Differentially expressed lncRNAs obtained from RNA-seq were verified by qRT-PCR. All the primer sequences were shown in Table 1. Total RNA from the 20 rats (OVX 10, sham 10) was reverse transcribed to cDNA according to the manufacturer’s instructions (SuperScriptTM III Reverse Transcriptase, Invitrogen). qRT-RCR was performed on a ViiA 7 real-time PCR system (Applied Biosystems) using a 2X PCR master mix (Arraystar). The reaction conditions included the following three steps: pre-denaturation at 95°C, 10 minutes; 40 cycles of denaturation (95°C, 10 seconds) and annealing/extension (60°C, 60 seconds); melt curve established by 95°C, 10 seconds; 60°C, 60 seconds; 95°C, 15 seconds. All reactions were performed in triplicate. The relative fold change was calculated using the standard curve method normalized to β-actin.

Chai S., Wan L., Wang J.L., Huang J.C, & Huang H.X. (2019). Systematic analysis of long non-coding RNA and mRNA profiling using RNA sequencing in the femur and muscle of ovariectomized rats. Journal of Musculoskeletal & Neuronal Interactions, 19(4), 422-434.

+ Open protocol

+ Expand

MeRIP-qPCR Analysis of Methylated RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Methylated RNA immunoprecipitation (MeRIP)-qPCR analysis was conducted to validate the microarray data. SuperScript^TM III Reverse Transcriptase (Invitrogen) was used to synthesize the first-strand cDNA from IP RNA, and the system of QuantStudio^TM 5 Real‑Time PCR (Applied Biosystems, Foster City, CA, USA) with 2X PCR master mix (Arraystar) was used to conduct RT-qPCR. The IP fraction in the input was calculated as MERIP/input (%) as described in Xing et al. 23 (link). Data are presented as means ± SEM. Primer sequences are displayed in Table 1.

Zhou Y., Li B., Wang Z., Tan W., Zou J., Zhou H., Cai Y., Liu J., He Y., Yoshida S, & Li Y. (2023). m6A modifications of circular RNAs in ischemia-induced retinal neovascularization. International Journal of Medical Sciences, 20(2), 254-261.

+ Open protocol

+ Expand

Validation of Circulating RNAs in Renal Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed qRT-PCR analysis of six circRNAs to validate the results of the microarray data. Briefly, the total RNA derived from the renal tissue samples was reverse-transcribed into complementary DNA (cDNA) with the help of SuperScript™ III Reverse Transcriptase (18080-044; Invitrogen, Waltham, MA, USA). According to the manufacturer’s instructions, 2X PCR Master Mix (AS-MR-006-5; Arraystar, Rockville, MD, USA) and ViiA 7 Real-Time PCR system (Applied Biosystems, Waltham, MA, USA) were used for qRT-PCR. The PCR primer sequences were outlined in Table 1. GAPDH was employed to serve as the internal control. Target gene expression was analyzed by the 2^−ΔΔCt equation.

Chen Q., Hong Z., Chen Z., Chen Y, & Liu D. (2023). CircRNA expression profiles and functional analysis in a mouse model of chronic intermittent hypoxia-induced renal injury: new insight into pathogenesis. PeerJ, 11, e14957.

+ Open protocol

+ Expand

qPCR Analysis of lncRNA GAS8-AS1

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR was conducted using 2X PCR master mix (Arraystar, Rockville, MD, USA) on a ViiA 7 Real-time PCR System (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. The primers for PTCSC3 and β-actin, which was selected as a housekeeping gene, were designed and synthesized by KangChen Bio-tech (Shanghai, China). Primer sequences were as follows: F 5′GACAAGACAACGAGCAAACAAG3′ and R 5′GGAGCCTCTAAAGGTCTGTGAC3′ for lncRNA GAS8-AS1 and F 5′GTGGCCGAGGACTTTGATTG3′ and R 5′CCTGTAACAACGCATCTCATATT3′ for β-actin. PCR was conducted as follows: 95°C denaturation for 10 min, followed by 40 cycles at 95°C for 10 s, 60°C for 60 s, and 95°C for 10 s. The relative expression level was analyzed using the 2^-ΔΔCT method. Each experiment was performed in triplicate.

Zhang D., Liu X., Wei B., Qiao G., Jiang T, & Chen Z. (2017). Plasma lncRNA GAS8-AS1 as a Potential Biomarker of Papillary Thyroid Carcinoma in Chinese Patients. International Journal of Endocrinology, 2017, 2645904.

+ Open protocol

+ Expand

Quantitative Analysis of lncRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

A reagent—2X PCR master mix (Arraystar, USA) was used according to the instructions of the QuantStudio5 Real-time PCR System (Applied Biosystems, USA). Primer 5.0 was used for primer design, and the primers used are shown in Table 1. The raw data were normalized to the expression of β-actin to obtain the relative expression of target lncRNAs.Table 1

The sequences of primers used for qRT-PRC

Gene symbol	Forward primer (5′ to 3′)	Reverse primer (5′ to 3′)
XR_338924	CTGCAAAGAGTGTGAAAATGC	GCCGACTTCAGGCACATAA
ENSRNOT00000078133	ACCAGGACCGCCCATAAATC	AAACCTTCAACAGTTTGACTGAA
ENSRNOT00000077292	GTGGGTTCCAGTTGATGACA	GGCATTGAATCCCATTACAG
ENSRNOT00000077294	TTCACCACCTACCTTCAGATTC	GCCCACCAACTAACCAACAA
uc.10-	TTCATGTCAAACCGCACTTAAT	TGAGTGTAGAGGAGCAGAGGC
NR_132636	AAACTGAACAAAACCTCGCC	GGTCTCTCTTCTCTCCCCTGCT
XR_146333	GCCTGAGTGAGTGACAGAATACC	TGTGATCCCAACCAGCCG
ENSRNOT00000077718	ACCTCTGACATCTTCCTTGAGA	GCTCTTCAGCATCCCTTACTAC

Wen Y., He C., Wang Y., Zeng S., Yang B, & Xiong X. (2022). LncRNA-mRNA co-expression analysis revealed 8 core lncRNAs in rheumatoid arthritis of collagen-induced arthritis rats. BMC Medical Genomics, 15, 244.

+ Open protocol

+ Expand

Quantitative Analysis of Differential circRNAs in Pancreatic Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from 10 pairs human pancreatic cancer tissue and corresponding paracancerous tissue was isolated using TRIzol reagent (Invitrogen). The cDNA synthesis of RNA was performed using SuperScript^™ III Reverse Transcriptase (Invitrogen). 10 differentially expressed circRNAs were respectively measured by qRT-PCR using 2X PCR Master Mix (Arraystar, Inc.) in pancreatic cancer tissue and corresponding paracancerous tissue. The reaction condition was as follows: 95°C for 10 min, 40 cycles of 95°C for 10 sec, 60°C for 60 sec, 95°C for 15 sec. The RNA levels were normalized to β-actin. All of the quantitative PCR reactions were conducted in triplicate. The related information of primers is shown in Table II. The specificity of PCR primers is validated using BLAST.

Guo S., Xu X., Ouyang Y., Wang Y., Yang J., Yin L., Ge J, & Wang H. (2018). Microarray expression profile analysis of circular RNAs in pancreatic cancer. Molecular Medicine Reports, 17(6), 7661-7671.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by TRI Reagent (Sigma) from a 50–100mg tissue sample. A total of 1.5 µg RNA was reverse transcribed into complementary DNA (cDNA) using a SuperScriptTM III Reverse Transcriptase kit (Invitrogen). Additionally, 375 ng of cDNA was used for the subsequent qPCR performed with the 2X PCR master mix (Arraystar). Amplification was performed in an QuantStudio™ 5 Real-time PCR System (Applied Biosystems) where β-actin expression was selected as an internal control. The fold changes of genes between the NS group and the normal group were calculated using relative quantification (the 2−ΔΔCt method). Primers used are listed in Table 1.Table 1

The Primer Sequences of Selected mRNA Genes and Transcripts That Were Differentially Expressed Between NS and Adjacent Normal Tissues

Gene Name	Bidirectional Primer Sequence	Annealing Temperature (°C)	Product Length (bp)
β-actin (Human)	F:5ʹGTGGCCGAGGACTTTGATTG3’R:5ʹCCTGTAACAACGCATCTCATATT3’	60	73
CDKN2AIP	F:5ʹGTGACAGATGCTCCAACCTAT3’R:5ʹTTGAACTGTTTTCCTGCTGAG3’	60	174
MACC1	F:5ʹAGGCATGTTTGAAGAGTACCC3’R:5ʹTTTGAGAGTTTTCCAGCTTCC3’	60	202
DDX5	F:5ʹCAAGAGCACCCTGATTTGGC3’R:5ʹTAGAACTGGCTTCGGGCAGT3’	60	105
RIF1	F:5’ ACCTGACTCTGACCAGTCGTATG 3’R:5’ GCAGCACTACTCAGCTCCGAG3’	60	136
BMPR2	F:5’ GAAACAAATCTGTGAGCCCAA3’R:5’ AGTCCAGCGATTCAGTGGAGA3’	60	184
KDM3A	F:5’ CACCGACGTTACCAAGAAGG3’R:5’ CCCAGAAAGCGAACAGAAGT3’	60	246

Yang X., Qiao R., Ni N., Zhang Q., Zhang K., Shao X., Cheng W., Sun J, & Jiang Y. (2022). Genome Wide Differential Expression Profiles in Nevus Sebaceous Uncovered Low Expression of CDKN2AIP and Construction of a ceRNA Network. Clinical, Cosmetic and Investigational Dermatology, 15, 519-533.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!